Results and Discussion

Materials and Methods Chapter 4 Table 4.1. Sequence of primers used in quantitative real-time PCR-based gene expression studies.

Sl.

No.

Target Gene

Oligo Sequence (5' to 3') 1. agrC Forward:

CCAGCTATAATTAGTGGTATTAAGTACAGTAAACT Reverse: AGGACGCGCTATCAAACATTTT

2. fnbA Forward: ACCAGTACCACCTGCCAAAG

Reverse: ACCAATGAAGCAATCAGAAAACACT

3. cnbA Forward: AATAGAGGCGCCACGACCGT

Reverse: GTGCCTTCCCAAACCTTTTGAGCA

4.2.7. Effect of C2 on agrC, fnbA and cnbA Gene Expression in MRSA

Cells of S. aureus 4s (~10⁶ CFU/mL) were grown in separate sets in BHI media incorporated with C2 (8.0 μM and 16 μM) at 37 ^ºC and 180 rpm for 9 h. Following treatment, the total RNA from MRSA cells was isolated using TRIzol™ Max™ Bacterial RNA Isolation Kit and 200 ng of RNA from each sample was used for quantitative real- time PCR under conditions described previously (Dey et al., 2020). The sequence of the primers for agrC, fnbA and cnbA gene used in qRT-PCR is depicted in Table 4.1. The fold change in the expression of the target genes was evaluated by the ΔΔCT method (Livak, et al., 2001). Statistical analysis for fold change in target gene expression was performed by a one-way analysis of variance (ANOVA).

Results and Discussion Chapter 4

69 Figure 4.1. Structure of quinoxaline-based synthetic ligands (C1-C4).

role of the electronic nature of the ligands in bactericidal activity, three derivative molecules (C2 to C4) were synthesized. C2 was derivatized with the strong electron withdrawing -NO2 group to make the scaffold electron deficient, whereas C3 and C4 were functionalized with electron donating basic (-NH2) and acidic (-COOH) group.

4.3.2. Antibacterial Activity of Ligands

With regard to bactericidal activity against MRSA, it was observed that only C2 exhibited prominent antibacterial activity against the clinical MRSA strain S. aureus 4s (Figure 4.2B). This suggested that the presence of a strong electron-deficient group (- NO2 group) perhaps contributes to the antibacterial activity of C2. The MIC of C2 against S. aureus 4s strain was determined to be 32 µM (Figure 4.2B), which was equivalent to that of CPX against the MRSA strain. The anti-MRSA activity of C2 was also captured in alamar blue dye assay, wherein reduction of resazurin, which can be considered as an index of the metabolic activity of live cells was dramatically reduced

TH-3020_166106018

Results and Discussion Chapter 4

Figure 4.2. Bactericidal activity of quinoxaline-based ligands (C1-C4) determined against S. aureus 4s strain by microtiter well broth dilution assay. Dashed arrow in (B) indicates the MIC level of C2 (32 µM) against the target MRSA strain.

Figure 4.3. Bactericidal activity of quinoxaline-based ligands (C1-C4) determined against

Results and Discussion Chapter 4

71 Figure 4.4. Bactericidal activity of C2 (32 μM) against S. aureus 4s cells ascertained by (i- iii) FESEM, (iv-vi) FETEM and (vii-ix) 2D AFM analysis. Scale bar for the images in (i-iii) is 1.0 µm. The arrows in panels ii, iii, v, vi, viii and ix indicate a loss of typical morphology in C2-treated MRSA cells.

upon treatment with C2 at a concentration of 32 µM and above (Figure 4.3B). The metabolic activity exhibited by the target MRSA strain remain virtually unaffected in presence of ligands C1 and C4 (Figure 4.3A-4.3D), while C3 could render a notable effect on the metabolic activity of MRSA only at very high concentrations of 256 µM and above (Figure 4.3C).

In order to substantiate the anti-MRSA activity of C2, microscopic analysis was pursued. In FESEM analysis, untreated cells of S. aureus 4s revealed a uniform margin and a morphology, characteristically associated with staphylococci (Figure 4.4, Panel i). However, cells treated with 32 M of C2 exhibited a distorted shape and were shrunken, which suggested extensive cellular damage (Figure 4.4, Panels ii-iii). Further, the magnitude of cell damage was higher when MRSA cells were treated with C2 for a longer period of time (Figure 4.4, Panels ii-iii). A similar effect was also captured in FETEM analysis of C2-treated MRSA cells (Figure 4.4, Panels iv-vi). The effect of C2 on MRSA cells was also observed through AFM analysis, wherein the characteristic spherical morphology of MRSA cell clusters was severely affected due to large scale cell

TH-3020_166106018

Results and Discussion Chapter 4

disruption (Figure 4.4, Panels vii-ix). The extent of cell damage in MRSA was validated by analysis of average height profile, which was observed to reduce from ~ 460 nm for untreated cells to ~ 341 nm and ~ 298 nm in case of cells treated with C2 for 6 h and 12 h, respectively (Figure A4.5 in Appendix).

4.3.3. Membrane-Directed Activity of Ligands

Given the strong bactericidal activity exhibited by the antimicrobial C2, experiments were conducted with cFDA-SE labelled MRSA in order to determine the membrane- directed activity of this ligand against the target pathogen. cFDA-SE labeled cells were selected for the assay as the amine reactive fluorophore is known to conjugate with intracellular proteins and thereby prevent passive leakage of the dye from viable cells (Hoefel et al., 2003). The potency of a membrane-targeting bactericidal agent can then be ascertained quantitatively by measuring the extent of retention of the cell-associated dye following membrane damage and dye leakage from treated cells. In the present study, it was observed that there was a systematic increase in the leakage of cFDA from MRSA cells upon treatment with an increasing concentration of C2. Herein, the extent of dye leakage from MRSA cells treated with 8.0 µM, 16 µM (0.5 × MIC) and 32 µM (equal to MIC level) was estimated to be ~20%, ~48% and ~80%, respectively (Figure 4.5A). Further, in case of untreated cells (control), the relative cell-associated cFDA-SE fluorescence intensity was high, which suggested the presence of a large population of viable cells (Figure 4.5B). Upon treatment with an increasing concentration of C2, there was a notable decrease in the cFDA-SE fluorescence intensity associated with MRSA cells, and apparently this phenomenon exhibited a dose-dependent effect (Figure 4.5B), akin to the earlier results obtained for dye leakage (Figure 4.5A). It can thus be conjectured that C2 displayed membrane-directed activity against MRSA wherein the ligand induced membrane damage and leakage of cFDA-SE dye from the affected cells.

Consequently, the population of cFDA-SE labelled viable cells was also reduced significantly in a dose- dependent manner as captured in the assay (Figure 4.5B).

4.3.4. Antibiofilm Activity of C2 against MRSA

S. aureus is of serious healthcare concern in the clinics as it is known to form resilient biofilms, which pose considerable therapeutic challenge (Turner et al., 2019; Stoodley et

Results and Discussion Chapter 4

73 Figure 4.5. (A) Membrane disruption activity of C2 against S. aureus 4s cells ascertained by measuring (A) leakage of cFDA-SE dye and (B) retention of cFDA-SE dye in C2-treated cells.

* in (B) indicates a p-value of <0.001 in one-way ANOVA.

Figure 4.6. (A) Crystal violet assay to determine the effect of C2 on MRSA biofilm biomass.

(B) MTT assay to ascertain the effect of C2 on MRSA biofilm metabolic activity.

that the antimicrobial C2 displayed significant bactericidal and membrane-directed activity, it was pertinent to ascertain the antagonistic effect of C2 against MRSA biofilm. To this end, solution-based assays based on crystal violet staining for biofilm biomass and MTT assay for biofilm metabolic activity revealed that C2 could impart a dose-dependent effect on the biomass as well as viability of MRSA biofilm (Figure 4.6A-4.6B). This observation indicated that the bactericidal effect of C2 against MRSA cells was retained even in the complex environment of a biofilm formed by the pathogen. It was also observed that the minimum biofilm inhibitory concentration (MBIC) of C2 against the tested MRSA strain S. aureus 4s was 32 µM, which also coincided with its MIC against the pathogen. The antagonistic effect of C2 on MRSA

TH-3020_166106018

Results and Discussion Chapter 4

Figure 4.7. (i-ii) FESEM, (iii-iv) 2D-AFM and (v-vi) 3D-AFM analysis to evaluate the antibiofilm effect of C2 (32 µM) against S. aureus 4s biofilm treated for 48 h.

biofilm by C2 was also evident in FESEM analysis wherein the quintessential cell-cell adhesion associated with MRSA biofilm was breached (Figure 4.7. Panels i-ii). AFM analysis provided further evidence of the activity of C2 against MRSA biofilm, wherein the typical cell morphology was obliterated and the average height profile of treated biofilm was reduced significantly as against the control cells (Figure 4.7, Panels iii-vi).

4.3.5. Effect of C2 on the Expression of agrC, fnbA and cnbA Genes in MRSA

In the context of wound-site infections and biofilm formation on medical devices by staphylococci, expression of cell surface adhesins that are implicated in binding to host extracellular matrix such as collagen and fibronectin have a critical role (Lee et al., 2018;

Aricola et al., 2012; Archer et al., 2011). In S. aureus, the accessory gene regulator (agr) locus is a key regulator, which governs the expression of several virulence factors such

Results and Discussion Chapter 4

75 Figure 4.8. Evaluation of agrC, fnbA and cnbA gene expression in S. aureus 4s treated with C2.

* indicates p value < 0.001 in one-way ANOVA.

fibronectin and fibrinogen (Novick, 2003; Jarraud et al., 2000; Aricola et al., 2012). It is also acknowledged that in S. aureus, agr is not involved significantly in early biofilm formation, while it accentuates biofilm dispersion (Aricola et al., 2012). However, following early biofilm development, there is an upregulation of the agr genes, which results in suppression of adhesins expression (Archer et al., 2011). In the current investigation, it was observed that the antimicrobial C2 displayed considerable activity against MRSA biofilm. Hence, it was conceived that it would be pertinent to conduct experiments and ascertain the effect of C2 on the expression of agr and the adhesin specific genes fnbA and cnbA coding for fibronectin binding protein and collagen binding protein, respectively, in MRSA. A qRT-PCR analysis indicated that the expression of agrC gene (coding for histidine kinase element of the agr operon) in MRSA was significantly downregulated upon treatment with sub-MIC levels of C2 in a dose- dependent manner (Figure 4.8A). To this end, the fold change in the expression of agrC in MRSA upon treatment with 8.0 µM and 16 µM C2 was observed to be ~0.30 and

~0.09, respectively (Figure 4.8A). The ability of C2 to downregulate agrC augers well as suppression of agr expression is likely to lead to lower levels of toxin production by MRSA, which in turn may reduce the risk of invasive as well as skin and soft tissue infections caused by the pathogen (Lee et al., 2018; Cheung et al., 2011). In case of the adhesin genes, it was observed that in presence of 8.0 µM C2, expression of fnbA and cnbA genes in the MRSA strain were elevated with the fold change in expression being

~3.0 and ~1.7, respectively (Figure 4.8B-4.8C). A suppressed level of expression of agrC observed earlier in presence of 8.0 µM C2 (Figure 4.8A) may account for the higher levels of fnbA and cnbA gene expression in MRSA, since it is known that agr can

TH-3020_166106018

Results and Discussion Chapter 4

negatively regulate adhesin gene expression agr genes, which results in suppression of adhesins expression (Archer et al., 2011). In comparison to the treatment with 8.0 µM C2, it was interesting to observe that in presence of 16 µM C2, which is equivalent to 0.5

× MIC against the tested MRSA strain, expression of both fnbA and cnbA genes were diminished with the fold change in expression being ~1.5 for both the genes (Figure 4.8B-4.8C). It is envisaged that the ability of C2 to dampen the expression levels of the adhesin genes fnbA and cnbA in a dose-dependent manner will be beneficial as a preventative therapeutic strategy against MRSA biofilm formation. To this end, it may be mentioned that in the current study, solution-based crystal violet and MTT assay have indeed revealed significant inhibition of MRSA biofilm formation when C2 was used at concentrations in excess of 16 µM (Figure 4.6). Based on its effect on the expression levels of the adhesin genes fnbA and cnbA, it is also envisioned that C2 can hold considerable potential as an anti-MRSA coating agent on catheters and other implanted medical devices as these adhesins are implicated in colonization of MRSA on medical devices and other abiotic surfaces (Lee et al., 2018; Aricola et al., 2012).