Vol. 46 (06), June 2017, pp. 1170-1174
Apoptotic effects of artificial feed supplemented with Thymus vulgaris on Oncorhynchus mykiss against Yersinia ruckeri
Altuğ KUCUKGUL1,*& Azime KUCUKGUL2
1 Mustafa Kemal University, Veterinary Faculty, TR31040, Hatay, Turkey
2 Munzur University, Fisheries Faculty, TR62000, Tunceli, Turkey [E. Mail: altug_kucukgul@mynet.com]
Received 26 June 2015 ; revised 21 December 2015
Chemical composition of the essential oil was analyzed by GC-MS, and found to contain the phenol (40.95 %) as major component. Results showed that Y. ruckeri (3 x 107cfu fish-1) infection caused the characteristic symptoms on rainbow trout (petechial hemorrhages on the surface of body and liver). Y. ruckeriinducedinhibitions of Cas-3, Cas-8, p53 and HSP-70. After the administration of thyme essential oil (10 mg kg-1 diet) to infected fish tissues, Cas-3, Cas-8, p53 and HSP-70 mRNAs were up-regulated by 9.31, 9.18, 9.58, and 6,1 fold change, respectively. According to the results of the study, the inhibitions seen all analyzed genes were due to Y. ruckeri infection. However, they were entirely increased by thyme treatment. Thus, targeting pro- apoptotic proteases by agents such as T. vulgaris could improve therapeutic options for infectious disease in fish.
[Keywords: Apoptotic genes; Oncorhynchus mykiss; Thymus vulgaris; Yersinia ruckeri]
Introduction
Yersinia ruckeri belongs to the family Enterobacteriaceae that it causes Enteric red mouth (ERM), also known as Yersiniosis. Y. ruckeri causes economic problems in aquaculture industry worldwide1,2. These economic problems in aquaculture systems can be reduced by decreased mortality and treatment with appropriate antibiotics.
However, because of the occurrence of resistant bacteria because of antibiotics usage, scientists recently focused on the usage experiments of natural antibacterial and antioxidants (medicinal plants or extracts from them) due to their antioxidant properties and phenolic contents to control bacterial and viral infections3.
Thyme (Tyhmus vulgaris L.) is that a Mediterranean aromatic plant has been used in traditional medicine for the treatment of several diseases for many years. Recently, thyme (extract or essential oilform) as natural antibacterial and antioxidant is used in the treatment of fish diseases by many researchers. Major bioactive compounds of the extracts from thyme essential oil are carvacrol and thymol4,5. Thymol exhibits multiple biological activities including anti-inflammatory6,
immunomodulation7, antioxidant8, antibacterial9, antifungal10, and free radical scavenging properties11. Carvacrol also possesses antimicrobial, antifungal, and antioxidant activities12,13, as well as antimutagenic and anticarcinogenic effects14.
Bacterial pathogens have developed different strategies to survive inside the host and to overcome their natural defenses, and thus cause disease. Therefore, the induction of host cell apoptosis by bacteria is considered an important mechanism for counteracting host immune defenses15,16. Apoptosis, known as programmed cell death, is characterized morphologically by phagocytosis of the cell by the macrophages. It progresses through a series of morphological changes mediated by the activation of specific cysteincysteine proteases named caspases17. Caspases (such as Cas-3 and Cas-8) are cysteine after aspartate residues and activate apoptosis in eukaryotic cells18. There are two different cell mechanisms that lead to apoptosis, those triggered by extrinsic factors which active tumornecrosisfactor-alpha (TNF-α) cytokine family (such as Fas ligand, TNF-relatedapoptosis-
inducingligand), those triggered by intrinsic factors which activate Bcl-2 proapoptotic family members (such as p53). In recent years, although scientists have focused on the importance of apoptotic cell death in the pathogenesis of fish diseases, now the investigations related to apoptosis still limited19,20,21,22. The Cas-3 gene has been sequenced and characterized in zebrafish23,24 and sea bass (Dicentrarchuslabrax L.)25.
Present study is to determine apoptotic effects of the feeding supplemented with thyme essential oil in liver of Y. ruckeri-infected fish.
Material and Methods
Y. ruckeri was obtained by Pendik Veterinary Research Institute (Istanbul, Turkey).
Before usage in experimental infections, bacteria were sub cultured on triptych soy agar (TSA, Oxoid) to check purity, and then transferred to triptych soy broth (TSB) for 24 h at 22°C.To determine the optimum bacterial cell concentration for the experiment, graded doses ranging from 1010 to 104 of cfu ml-1were utilized. The median lethal dose (LD50) calculated by the method of Reed-Muench (1938) was 3 × 107 cfu·ml-1 and this concentration was used for the experiment26.
The essential oil compositions of thyme that obtained from a commercial firm were provided by gas chromatography–mass spectrometry (GC-MS) in Laboratory of Marmara Research Center Food Institute. GC-MS analyses were carried out on a Shimadzu GC-9A gas chromatograph equipped with Thermon-600 T (30 m × 0.25 mm × 0.25 μm film thickness)27.
Feeding with commercial pellet feed at 3 % rate of body weight, 15±1 oC temperature, 12 h light/12 h dark period, aeration flow-through well water as acclimation conditions were provided.
Totally 240 fish weighted 84±1.02 g, Mean±SEM were divided randomly into triplicated (20x3=60) in each group, maintained in 12 tanks (450 L capacity).
To test the apoptotic effect of T. vulgaris (TV) on infected rainbow trout four experimental group were formed. The first group used as the control group was fed a commercial tout feed (Kılıç/Turkey) (3%
biomass per day). All fish of the second group were infected by intraperitoneal injection (i.p.) with 3 x 107cfu fish-1 (Y. ruckeri) a previously determined LD50. The third group was only with supplemented TV essential oil (10 mg kg-1 diet). The last group was both infected and fed with feed containing the essential oil of TV. The use of essential oil during the experimental stages was performed via pulverization method. The feed was spread on aluminum folio and determined doses of the oils were pulverized onto the feed.
Liver samples from fish in each group (totally 4 groups) were removed at 3th days of the experimental period. Previous studies have shown that the 3rd day showed peak levels of bacterial growth, therefore, day 3 was chosen as sample time28. The Cas-3, Cas-8, HSP-70 and p53 expression analysis was performed in liver tissue.Each specimen was preserved in RNA later, for further use.
Real-time PCR was performed in a BIO- RAD life science PCR system (CFX96-C1000 Touch/Singapore). Total RNA from fish hepatic tissue cells were extracted by using Trizol reagent (Sigma, USA) according to the manufacturer’s instructions. One micrograms of total RNA were reverse transcribed in a reaction volume of 20-µl using reverse transcriptase kit (Fermentas, EU). One micro liter of each cDNA was used as templates for amplification using SYBER Green PCR amplification For Peer Review 3 reagent and gene- specific primers. The primer sets used were from Thermo Electron Corporation (Germany): Cas-3 Reverse: 5’–TGC ACA TCC ACG ATT TGA TT-3’ , Forward: 5’-TTT GGG AGT AGA TTG CAG GC- 3’; Cas-8 Reverse: 5’-TGA CTG AGG GGA GCT GAG TT-3’, Forward: 5’- CAG CAT AGA GAA GCA AGG GG-3’; HSP-70 Reverse: 5’-AGG CCC AAC CAT TGA AGA GA-3’, Forward: 5’-GCA ATG TCC AGC AAT GCA ATA- 3’,p53 Reverse:
5’-AGG CCC AAC CAT TGA AGA GA-3’, Forward: 5’-GCA ATG TCC AGC AAT GCA ATA- 3’. The amount of RNA was normalized to GADPH amplification in a separate reaction Forward
5’CCACCCATGGCAAATTCCATGGCA3’,Revers e5’TCTAGACGGCAGGTCAGGTCCACC 3’. The threshold cycle (Ct) values for the transcripts were normalized to GADPH by subtracting the average Ct value for each treatment. Each PCR reaction was performed in triplicate. mRNA transcription values were determined as down- or up regulated for each gene.
The one-way analysis of variance (ANOVA) and post hoc Duncan tests were performed on the data to examine the differences among groups using the SPSS statistical software package (SPSS1 for Windows v. 20.0). Results were presented as average ± SE. A value of p< 0.05 was considered significantly.
Results and Discussion
Yersinia ruckeri is causative agent of Yersiniosis lead to significant economic loses in salmonid aquaculture worldwide (Horne & Barnes, 1999). Results of this study showed that, when fish infected with Y. ruckeri (3x107 cfu fish-1), there were
the characteristic hemorrhages in, around the oral cavity, and on the body surface. Petechial hemorrhages in internal organs such as spleen, liver and kidney were common. Fouzet al.1 and Tobbacket al.2have reported the similar observations, such as general septicemia condition with hemorrhages on the body surface and subcutaneous hemorrhages in mouth cavity.
The use of antibiotics in treatment of fish diseases may involve a broad environmental application that affects a wide variety of bacteria.
However, resistance can be developed among bacteria, and antibiotic-resistant bacteria may not respond to antibiotic treatments. Therefore, the available studies have focused on using of natural products as alternative instead of antibiotic therapy.
Essential oils are volatile liquid fractions that contain the substances responsible for thearomas of plants29. Primary roles of essential oils in plants are believed to be as defenses against pathogens due to their antibacterial, antiviral, antifungal. The essential oils of many plants contain phenolic compounds, and these comprise the majority of plant antimicrobial components30,31,32,33. Similarly, our results showed that the most important components of thyme essential oil tested by GC-MS analyses were phenol (40.95 %) and2- methyl-5-(1-methylethyl) (12.12 %).Examples of the in vivo use of essential oils in aquaculture systemsare scarce but promising. As shown in the present study, in vivo use of thyme essential oil to Y.
ruckeri showed a positive effect on reduced mortality of infected fish. A similar study, channel catfish (Ictalurus punctatus) fed with the natural oregano essential oil (EO) extracted from Origanum heracleoticum had the lowest mortality following an Aeromonas hydrophila infection compared with fish fed a combination of carvacrol and thymol, which are the principal active components of oregano EO34.
Cell death is the most common outcome of host–bacterial pathogen interactions and has important consequences for pathogenesis35. Bacteria, viruses and parasites can either induce or prevent apoptosis to augment infection36,37. Many bacterial pathogens that cause apoptosis target immune cells that these cells would otherwise kill the pathogens34,38. Caspases, a family of cysteine proteases, play critical roles in apoptosis. Majority of the published studies have described apoptosis and caspases in many animal species and humans, however, information on both the apoptotic process and the enzymes involved are limited in fish. The caspase-3 gene related to apoptosis was studied in
many investigations23,25,39.
In our study, Y. ruckeri exposure significantly decreased Cas-3 (2.68 fold), cas-8 (1.80 fold), p53 (1.75) and HSP70 (1.88 fold) mRNA expressions in comparison with control cells (Fig 1 A-C). As shown in the same figure, though Thyme vulgaris administration Cas-3, Cas-8, p53 and HSP-70 mRNAs were up-regulated by 9.31, 9.18, 9.58, and 6,1 fold change, respectively. A similar kind of observation has been reported by Mary Liniet al.24, and decrease in the expression of caspase 3 has been showed in infected tissues with Aeromonas hydrophila showed. They suggested that A. hydrophila used a different mechanism to evade host immune response by inducing phagocyte suicide by apoptotic caspases. In other reported by Laing et al.40, a marked up-regulation of Cas-6 expression in the trout head kidney by addition of LPS was observed upon in vivo induction of confinement stress. However, in other a study has been reported by Sepulcreetal.41 who suggested that Vibrio anguillarium evades the immune response of the bony fish sea bass (Dicentrachus labrax) through the down regulation of apoptotic caspases.
Possibly, this is due to the effect of dosage and the duration of administration.
*¥ p
**p
**p
**p
*¥ p
**p
A
B
Fig. 1____Quantitative RT-PCR analyses of Cas-3, Cas-8, p53 and HSP-70. The mRNA levels of Cas-3, Cas-8, p53 and HSP-70 were determined by qRT-PCR in order to confirm the protective effects of thyme essential oil against Yersinia ruckeri-induced apoptotic activity in rainbow trouts. As shown in Fig. 1 A-D; Y. ruckeri induced inhibitions of Cas-3, Cas-8, p53 and HSP-70 were entirely increased by thyme treatment.
Results were obtained using real-time RT-PCR and expressed as a relative increase of mRNA expression compared with control cells. Experiments shown are representative of three separate experiments with similar results. *¥ p < 0.05 versus control group; **p <0.05 versus Yersinia injection groups. C: Control, YR: Yersinia ruckeri, TV: Thyme vulgaris, + TV: Yersinia ruckeri plus Thyme vulgaris.
After post-stimulation by essential oils, essential oil-induced apoptosis may activatepro- apoptotic genes (as caspase pathway). The pathways that are activated by a mixture of chemical components in essential oil are expected to more complicate than the results presented in this communication43. However, essential oils-activated cell death pathways are still under intensive investigation in all living organism. In our this report, thyme essential oil-induced feeding treatment to infected tissues which is the main objective of this study, the levels of all apoptotic genes were up- regulated approximately 10 fold change expect compared to infection group.
Conclusion
The ability of T. vulgaris to attenuate Yersinia ruckeri induced by inflammation could be attributed to the pro-apoptotic action of T. vulgaris.
It is suggested that T. vulgaris is a promising agent that could help in the prophylaxis and treatment of Gram (+) infections. Thus, targeting pro-apoptotic proteases by agents such as T. vulgaris could improve therapeutic options for infectious disease in fish.
References
1. Fouz, B., Zarza, C.andAmaro, C., First description of non- motile Yersinia ruckeri serovar I strains causing disease in rainbow trout, Oncorhynchus mykiss (Walbaum), cultured in Spain, J. Fish Dis., 29 (2006) 339–346.
2. Tobback, E., Decostere, A., Hermans, K., Haesebrouck, F.and Chiers, K.,Yersinia ruckeri infections in salmonid fish, J. Fish. Dis., 30 (2007) 257–268.
3. Akhtar, P., Gray, J., Booren, A. and Gomaa, E., The effects of dietary alpha-tocopherol and surface application of oleoresin rosemary on lipid oxidation and cholesterol oxide formation in cooked rainbow trout (Oncorhynchuskisutch) muscle, J. Food Lipids, 5(1998) 59-71.
4. Hudaib, M., Speroni, E., Pietra, A.M. and Cavrini, V., GC/MS evaluation of thyme (Thymus vulgaris L.) oil composition and variations during the vegetative cycle, J.
Pharmaceut. and Biomed., 29(2002) 691–700.
5. Tian, H. and Lai, D.M., Analysis on the volatile oil in Origanum vulgare,Zhong Yao Cai., 29(2006) 920–921.
6. Braga, P.C., Dal Sasso, M., Culici, M., Bianchi, T., Bordoni, L. and Marabini, L., Anti-inflammatory activity of thymol: inhibitory effect on the release of human neutrophil Elastase, Pharm., 77(2006) 130–136.
7. Suzuki Y., Furuta, H., Stimulation of guinea pig neutrophil superoxide anion-producing system with thymol, Inflammation, 12 (1988) 575-584.
8. Aeschbach, R., Loliger, J., Scott, B.C., Murcia, A., Buttler, J., Halliwell, A. and Aruoma O.I., Antioxidant actions of thymol, carvacrol, 6-gingerol, zingerone and hydroxytyrosol, Food Chem. Toxicol., 32(1994) 31–36.
9. Didry, N., Dubreuil, L. and Pinkas, M., Activity of thymol, carvacrol, cinnamaldehyde and eugenol on oral bacteria, Pharmaceutica Acta Helvetiae, 69(1994) 25–28.
10. SegviKlari, M., Kosalec, I., Masteli, J., Pieckov´a, E. and Pepeljnak, S., Antifungal activity of thyme (Thymus vulgaris L.) essential oil and thymol against moulds from dampdwellings, Lett.Appl. Microbiol., 44(2007) 36–4.
11. Fujisawa, S. and Kadoma, Y., Effect of phenolic compounds on the polymerization of methyl methacrylate, Dental Materials, 8(1992) 324–326.
12. Alma, M.H., Mavi, A., Yildirim, A., Digrak, M. and Hirata, T., Screening chemical composition and in vitro antioxidant and antimicrobial activities of the essential oils from Origanum syriacum L. growing in Turkey, Biol.
Pharm. Bulletin, 26(2003) 1725–1729.
13. Bozin, B., Mimica-Dukic, N., Samojlik, I. and Jovin, E., Antimicrobial and antioxidant properties of Rosemary and Sage (Rosmarinus officinalis L. and Salvia officinalis L., Lamiaceae) essential oils, J. Agricult. Food Chem., 55(2007) 7879–7885.
14. Arcila-Lozano, C.C., Loarca-Pina, G. and Lecona-Uribe,
*¥ p
**p
*¥ p
**p
C
D
S., Oregano: properties, composition and biological activity, Arch. Latino americanos de Nutricion, 54(2004) 100–111.
15. Moss, J.E., Aliprantis, A.O. and Zychlinsky, A., The regulation of apoptosis by microbial pathogens ,Int. Rev.
Cytol.,187(1999) 203-259.
16. Weinrauch, Y., Zychlinsky, A., The induction of apoptosis by bacterial pathogens, Annual. Rev. Microbiol., 53(1999) 155-187.
17. Fan, T.J., Han, L.H., Cong, R.S. and Liang, J., Caspase family proteases and apoptosis, Acta.Bioch.Bioph.Sin., 37(2005) 719–727.
18. Reed, J.C., Mechanisms of apoptosis, Am. J.
Pathol.,157(2000) 1415-1430.
19. Toplu, N., Albayrak, H., Aydoğan, A., Epikmen, E.T., Metin, N., Gökkuşağı alabalıklarında (Oncorhynchus mykiss Walbaum, 1792) enfeksiyöz pankreatik nekrozun patogenezisinde apoptozisin rolü, Ankara Üniv. Vet.
Fak.Derg., 57(2010) 191-196.
20. Nolan, D.T., Nabben, I., Li, J. and WendelaarBonga, S.E., Characterization of primary culture of rainbow trout (Oncorhynchus mykiss) skin explants: growth, cell composition, proliferation and apoptosis, In Vitro Cell &
Dev Biol-Animal, 38(2002) 14-24.
21. Hong, J.R., Lin, T.L., Hsu, Y.L. and Wu, J.L., Apoptosis procedes necrosis of fish cell line by infectious pancreatic necrosis virus, Virol.,250(1998) 76-84.
22. Taylor, S.L., Jaso-Friedmann, L., Allison, A.B., Eldar, A.and Evans, D.L.,Streptococcus iniae inhibition of apoptosis of nonspecific cytotoxic cells: a mechanism of activation of innate immunity in teleosts, Dis. Aquatic.
Organisms, 46(2001) 15–21.
23. Eimon, P.M. and Ashkenazi, A., The zebrafish as a model organism for the study of apoptosis, Apoptosis, 15(2010) 331-349.
24. Mary Lini, R., Pani, P.K., Gireesh, B. and Purushothaman, C.S., Effect of Aeromonas hydrophila infection on caspase-3 expression and activity in Rohu, Labeorohita, J.
Aquacult. Res. Dev., 4 (2013) 6-12.
25. Reis, M.I., Nascimento, D.S., do Vale, A., Silva, M.T. and dos Santos, N.M., Molecular cloning and characterisation of sea bass (Dicentrarchus labrax L.) caspase-3 gene, Mol. Immunol.,44(2007) 774-783.
26. Reed, LJ, Muench H. A simple method of estimating fifty per cent endpoints. , Am J Hyg, 27 (1938) 493-497 27. Bagamboula, C.F., Uyttendaele, M. and Debevere, J.,
Inhibitory effect of thyme and basil essential oils, carvacrol, thymol, estragol, linalool and p-cymene towards Shigella sonnei and S. flexneri, Food Microbiol., 21(2004) 33-42.
28. Raida, M.K. and Buchmann, K.,Innate immune response in rainbow trout (Oncorhynchus mykiss) against primary and secondary infections with Yersinia ruckeri O1, Dev.
Com. Immunol.,33(2009) 35-45.
29. Bakkali, F., Averbeck, S., Averbeck, D.and Idaomar, M., Biological effects of essential oils, Food Chem. Toxicol., 46(2008) 446-475.
30. Garcia-Garcia, R., Lopez-Malo, A .and Palou E.,Bactericidal action of binary and ternary mixtures of carvacrol, thymol, and eugenol against Listeria innocua, J.
Food Sci., 76(2011) 95-100.
31. Bagamboula, C.F.,Uyttendaele, M., Debevere, J., Inhibitoryeffect of thymeand basil essentialoils, carvacrol, thymol, estragol, linalooland p-cymenetowards ShigellasonneiandS. flexneri, FoodMicrobiol., 21(2004) 33–42.
32. Calsamiglia, S., Busquet, M., Cardozo, P.W., Castillejos, L.and Ferret, A., Invited review: Essential oils as modifiers of rumen microbial fermentation, J. Dairy Sci., 90(2007) 2580-2595.
33. Delaquis, P.J., Stanich, K.,Girard, B. and Mazza, G., Antimicrobial activity of individual and mixed fractions of dill,cilantro, coriander and eucalyptus essential oils, Int.
Food Microbiol.,74(2002) 101–109.
34. Zheng, Z.L., Justin, Y.W., Liu, H.Y., Evaluation of oregano essential oil (Origanumheracleoticum L.) on growth, antioxidant effect and resistance against Aeromonas hydrophila in channel catfish (Ictalurus punctatus), Aquacult., 292(2009) 214-218.
35. Labbé, K. and Saleh, M., Cell death in the host response to infection,Cell Death Differ., 15(2008), 1339-1349.
36. Hay, S. and Kannourakis, G., A time to kill: viral manipulation of the cell death program, J. Gen. Virol., 83(2002) 1547-1564.
37. Bruchhaus, I., Roeder, T., Rennenberg, A.andHeussler, V.T., Protozoan parasites: programmed cell death as a mechanism of parasitism, Trends Parasit., 23(2007) 376- 383.
38. Kobayashi, S.D., Braughton, K.R., Whitney, A.R., Voyich, J.M. and Schwan, T.G., Bacterial pathogens modulate an apoptosis differentiation program in human neutrophils, P. Natl. Acad. Sci., 100(2003) 10948-10953.
39. Yabu, T., Kishi, S., Okazaki, T. andYamashita, M., Characterization of zebrafish caspase-3 and induction of apoptosis through ceramide generation in fish fathead minnow tailbud cells and zebrafish embryo, Biochem. J., 360(2001) 39-47.
40. Laing, K.J., Holland, J., Bonilla, S., Cunningham, C., Secombes C.J., Cloning and sequencing of caspase 6 in rainbow trout, Oncorhynchus mykiss, and analysis of its expression under conditions known to induce apoptosis.
Dev. Comp. Immunol.,25 (2001) 303-312.
41. Sepulcre, M.P., López-Castejón, G., Meseguer, J. and Mulero, V., The activation of gilthead seabream professional phagocytes by different PAMPs underlines the behavioural diversity of the main innate immune cells of bony fish, Mol. Immunol., 44(2007) 2009-2016.
*¥ p
