These organisms are grouped together because they are capable of ‘escaping’ the biocidal action of antibiotics and representing new hurdles in treatment by their drug resistance mechanisms

(1)

INTRODUCTION

Intensive care units (ICU) cater to patients with severe, life-threatening illnesses and injuries that require constant, vigilant monitoring and life support with specialised equipments and medications.

Patients with various medical and surgical conditions requiring critical care are admitted in ICU’s. The common conditions for which patients require Intensive care like Circulatory failure, Acute and Chronic Respiratory Failure, Sepsis, Renal failure, various neurological disorders , haematological disorders, Multiple Organ Dysfunction Syndrome – MODS and Severe traumatic injury etc. have now become very common, hence increasing the need for ICU admission.

Consequently ICU’s serve as epicentre of infections and Health care associated infections occur at highest rates in the ICU population when compared with those occurring in patients admitted in general wards,i.e 20- 30% of all ICU-admissions ^[1,2], leading to an enormous impact on morbidity and mortality.

The ICU’s have been widely studied for dissemination of antimicrobial resistance among this vulnerable population, as they harbour Multiple-Drug Resistant (MDR) organisms.

Infection with MDR bacteria increased the immensity of clinical and economic burden. The presence of MDR poses deleterious impact on infection causing organisms are MDR.^[3,4,5]

(2)

Over the last few decades, there has been unrelenting proliferation of group of Multi Drug Resistant Bacteria mainly caused by Enterococcus species, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter species - acronymically termed as “ESKAPE” pathogens^[6]. These organisms are grouped together because they are capable of ‘escaping’ the biocidal action of antibiotics and representing new hurdles in treatment by their drug resistance mechanisms. Moreover these organisms constitute majority of Hospital acquired infections and frequently exhibit multidrug resistance.MDR is defined as non-susceptibility to atleast one agent in atleast three antimicrobial classes of drugs^[7].

Global and regional surveillance of ESKAPE group of pathogens is highly recommended to control the infections caused by these pathogens.

The purpose of this study was to monitor the incidence and distribution of ESKAPE group of pathogens and their antimicrobial susceptibility and resistance pattern in critically ill patients with infections, admitted in ICU of a tertiary care hospital. The knowledge about Institutional antimicrobial susceptibility and resistance pattern would aid in selecting a appropriate empirical treatment of infections caused due to ESKAPE group of pathogens which would help in decreasing the morbidity and mortality due to MDR pathogens.

(3)

AIMS AND OBJECTIVES AIMS:

To study the distribution of “ESKAPE” (Enterococcus species, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter species) group of pathogens and determine their Antimicrobial susceptibility and resistance pattern in Intensive Care Unit Patients.

OBJECTIVES:

 To isolate and identify the “ESKAPE” group of pathogens from Intensive Care Unit patients.

 To study the drug susceptibility and resistance patterns of the isolates.

 To characterize the resistant isolates phenotypically.

 To characterize genotypically, the predominant pathogen among the resistant ESKAPE group of bacterial isolates.

(4)

REVIEW OF LITERATURE

Over the past few decades, there has been a substantial increase in antimicrobial resistance caused by Gram negative and Gram positive organisms. The organisms which show resistance in higher frequencies have been grouped under an acronym ESKAPE: Enterococcus species, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter species.^[1] These pathogens are capable of “escaping” the biocidal action of antibiotics.

The increasing isolation rate of these multidrug resistant organisms pose a serious concern especially in hospital acquired infections as they are associated with higher mortality rate. Stringent surveillance of these ESKAPE pathogens is mandatory to prevent and control the infections caused by them.

Multidrug resistance is caused mainly due to injudicious use of antimicrobials ,over the counter prescription, inappropriate and inadequate dosing and substandard pharmaceuticals.^[3] Better understanding of the resistance mechanisms will aid in development of novel antimicrobial agents or other alternative tools to combat the public health issues.

The Intensive Care Unit patients are highly vulnerable population to infections with multidrug resistant organisms due to various reasons such as

 Reduced host defence mechanisms deregulating the host immune responses

(5)

 Multiple procedures and use of invasive devices disturbing the anatomical integrity i.e protective barriers of patients (intubation, mechanical ventilation, urinary catheters, peripheral and central vascular access etc.).

 Extravagant and inappropriate antibiotics utilization

 Drugs administered, which may predispose to infections by various mechanisms, such as in pneumonia by reducing the cough and swallow reflexes (sedatives, muscle relaxants) or in stress gastric and duodenal ulcer prophylaxis by distorting the normal non-pathogenic commensal bacterial flora ^[8]

INCIDENCE AND EPIDEMIOLOGY

According to the EPIC II 1-day prospective point-prevalence study (Extended Prevalence of Infection in Intensive Care) by Vincent JL et al- in which 1,265 ICUs among the 75 countries worldwide participated in the study,51% of the 12,796 patients were considered infected^[9]

More than 20 % of hospital acquired infections are acquired in ICUs, and sepsis is a leading cause of death among infected patients, particularly in those admitted to medical and surgical ICUs.^[9]

Along with the problem of hospital acquired infection goes the burden of “multidrug” antimicrobial resistance (MDR). Due to the high risk profile of its residents the ICU’s are a vital centre of multidrug resistance development.

Gram-negative bacteria are largely responsible for infections in ICU patients and multi-drug resistant (MDR) strains are increasingly isolated^[10,11].

(6)

Unfortunately, multidrug-resistant organisms, including Pseudomonas aeruginosa, Acinetobacter baumannii, and extended-spectrum β-lactamase (ESBL)–producing or carbapenemase-producing Enterobacteriaceae, are being increasingly reported nowadays. ^[11]

In the last two decades, there has been a considerable increase in both the number and the severity of infections caused by Gram-positive bacteria.

The increasing burden of Gram-positive infections is mainly by Staphylococcus aureus and Enterococcus spp attributed predominantly to the current use and abuse of catheters and other intravascular devices.^[12]

Risk factors for developing infections^[13]

 Hospitalisation for ≥ 2days in the preceding 90 days

 Residence in nursing home or long term care facility

 Home infusion therapy including antibiotic treatment

 Long term dialysis within 30 days

 Home wound care with no supervision

Risk factors for acquiring infections with multi drug resistance^[13]

 Antimicrobial therapy in the preceding 90 days

 Current hospitalization for ≥5 days

 High frequency of antibiotic resistance in the community or in the specific hospital unit

 Family member with multidrug-resistant pathogen

 Immunosuppression

(7)

Emergence and spread of MDR organisms

Bonten and Mascini recognized four main forces behind the emergence and further spread of MDR microorganisms ^[14] :

1) Induction of resistant strains 2) Selection of resistant strains 3) Introduction of resistant strains 4) Dissemination of resistant strains

These alterable forces must be considered to tackle the spread of antimicrobial resistance, because microorganisms have their own mechanism to become resistant depending on their ideal environment to counteract antimicrobial efficacy.

Induction of resistant strains

Resistance of susceptible bacteria can occur during antimicrobial treatment, e.g., by mutations in genes. Quinolone and cephalosporin resistance in Enterobacter spp. arise through this mechanism.

Selection of resistant strains

Inappropriate antimicrobial therapy may selectively favor the overgrowth of preexisting resistant organism. For example, it is important to maintain the nonpathogenic flora in the gastrointestinal tract, to prevent overgrowth of gram-negative MDR microorganisms.

Introduction of resistant strains

The increasing community reservoir of MDR organisms results in a rise of MDR organisms in the ICU, especially for MRSA and VRE. Healthcare

(8)

workers often act as carriers but also can be vectors (cross-transmission). When colonization pressure with resistant strains is above a certain level, the risk of cross-transmission becomes extremely high and very difficult to overcome (inoculum effect) ^[14].

Dissemination of resistant strains

Suboptimal infection control also facilitates the spread of MDR microorganisms

Antimicrobial Resistance Mechanisms of ESKAPE Pathogens^[3]

Antimicrobial resistance genes may be carried on the bacterial chromosome, plasmid, or transposons. Various mechanisms of acquiring resistance have been listed below

Table 1: MECHANISMS OF DRUG RESISTANCE

MECHANISM OF

DRUG RESISTANCE REASON

ESKAPE ORGANISM EXHIBITING THE

MECHANISM Drug inactivation or

alteration^[15]

Production of β lactamases or aminoglycoside modifying enzymes

Klebsiella pneumoniae Pseudomonas aeruginosa Acinetobacter baumannii Enterobacter cloacae

Modification of drug binding sites^[16]

Alteration in Penicillin binding proteins(native PBP to PBP2a)

Staphylococcus aureus(MRSA) Alteration of D-Ala-D-Ala

residues to D-Ala-D-Lac Enterococcus faecalis(VRE)

Porin loss^[3] Reduced Intracellular drug accumulation

Imipenem resistance in Pseudomonas aeruginosa, Acinetobacter baumannii and Klebsiella pneumoniae Cephalosporin resistance in Klebsiella pneumoniae

Efflux pumps^[17] Reduced Intracellular drug accumulation(MDR)

Pseudomonas aeruginosa Enterobacter aerogenes Klebsiella pneumoniae

(9)

Figure1- RESISTANCE MECHANISMS IN GRAM POSITIVE AND GRAM NEGATIVE BACTERIA

Antibiotic Resistance in ESKAPE Pathogens 1. Enterococcus species

They are normal commensals of the gastro intestinal tract of humans and animals. Enterococcus faecium and Enterococcus faecalis are the clinically important species . Most Enterococcus infections are endogenously acquired, but cross-infection may occur in hospitalized patients ^[19] .Infections include urinary tract infections, bacteremia,endocarditis, mixed infections of abdomen and pelvic wounds, and occasionally, ocular, CNS and respiratory infections.

[20]

Over the past decade, there has been a rise in vancomycin-resistant enterococcal infections in healthcare settings. There are six types of VRE

(10)

(Van-A–E and Van-G).Van-A is the most prevalent and shows highest levels of resistance to glycopeptide antibiotics.

In 2011, Galloway-Pena et al demonstrated two different clades of Enterococcus that differ genetically. Clade A isolates were hospital acquired, whereas Clade B isolates were community acquired. Both clades express low affinity penicillin-binding proteins (PBP5) exhibiting weak affinity to -lactam drugs. In addition, clade A has acquired resistance genes encoding the ampicillin-resistant PBP5 (pbp5R) while clade B has been shown to harbour genes encoding for ampicillin-sensitive PBP5 (pbp5S) ^[21]

IMPORTANT VRE GENES AND THEIR CHARACTERISTICS^[22]

Characteristics VanA VanB VanC VanD VanE VacomycinMIC(µg/mL) 64-≥1024 4-1024 2-32 64-256 16

VacomycinMIC(µg/mL) 16-512 ≤0.5 ≤0.5 4-32 0.5

Enterococcus species E.faecium E.faecalis

E.faecalis E.faecium

E.gallinarum

E.casseliflavus E.faecium E.faecalis

Gene VanA

cluster

VanB cluster

VanC1,VanC2 cluster

Van D cluster

VanE cluster Mode of inheritance Acquired Acquired Intrinsic Acquired Acquired

Transferability Yes Yes No - -

2. Staphylococcus aureus:

Staphylococcus aureus is part of the normal skin flora, mainly distributed in the anterior nares,nasopharynx and perineum of humans and animals. Carriage rates are high in general population and transmission occurs by direct contact or airborne routes.Infections caused by Staphylococcus aureus include skin and soft tissue infections,wound infections,

(11)

bacteremia,endocarditis, osteomyelitis and rarely CNS infections and Pyelonephritis. ^[20]

In India studies report that methicillin-resistant Staphylococcus aureus (MRSA) are estimated to account for 25% of Staphylococcus aureus isolates, with a prevalence of up to 50%^[23]. Methicillin resistance in S.aureus is mediated by chromosomally encoded mecA gene and rarely mecC. Expession of MecA can be constitutive or inducible.

Infections caused by MRSA can be classified into

1. Community acquired: These strains express MecA typesIV,V,VI.

They predominantly cause skin and soft tissue infections.These strains are more virulent than hospital acquired strains^[24]

2. Hospital acquired: These strains express MecA typesI,II,III. They predominantly cause perioperative wound infections. These strains are more multidrug resistant than Community acquired strains. ^[24]

Glycopeptide antibiotics such as vancomycin and teicoplanin, are prescribed as first-line antibiotics for treatment of MRSA infections.

Consequently, the selective pressure on these antibiotics has induced clinical strains to become intermediate-susceptible to vancomycin with cases of clinical vancomycin-intermediate and vancomycin-resistant S. aureus (VISA and VRSA) on the rise ^[25] .

VRSA is of particular concern because of the transferrable resistance genes from VRE. VRSA isolates harbour both the van-A and mec-A genes of VRE and MRSA, ^[26]

(12)

3. Klebsiella pneumoniae:

Klebsiella species are often associated with various infections in healthcare settings which may be endogenous or acquired through direct contact with an infected host. Infections caused by Klebsiella species include a wide variety of hospital acquired infections of the respiratory tract, urinary tract, blood, and several other normally sterile sites in frequently hospitalized and seriously debilitated patients.^[20] .

Klebsiella species account for about 6 to 17% of all hospital acquired infections and shows higher incidence in specific group of patients at risk especially in ICU’s as described in a study by Bennet CJ et al. ^[27]

Extended Spectrum beta lactamases (ESBL) producing Klebsiella pose serious therapeutic challenge to clinicians due to limited therapeutic options.

ESBL are plasmid encoded leading to transferrable resistance.

Carbapenems are traditionally used to treat persistent infections caused by Gram-negative bacteria and ESBL producing strains.

The overusage of Carbapenemes has lead to the increasing prevalence of carbapenem-resistant K. pneumoniae (CRKP), with resistance encoded by blaKPC^[28]. In addition to this, recent emergence of the K. pneumoniae super enzyme,known as NDM-1 and encoded by blaNDM-1, has increased the proportion of carbapenem-resistant K. pneumoniae isolates. ^[29]

4. Acinetobacter baumannii:

Acinetobacter species are widely distributed in the environment and easily contaminate the hospital environment. Acinetobacter baumannii has a

(13)

relatively long survival time on human hands leading to high rates of cross contamination in hospital acquired infections ^[30] . They are often colonizers and true infections are usually hospital acquired, occuring during warm seasons, and involving the genitourinary tract, respiratory tract, wounds, soft tissues, and bacteremia ^[20].

Over the decade, the emergence of carbapenemase producing strains carrying imipenem metallo- -lactamases( encoded by blaIMP) and oxacillinase serine -lactamases (encoded by bla ) has been reported worldwide. These strains show resistance to both colistin and imipenem, and the combination of resistance genes poses hurdles due to therapeutic failure.^[31]

5. Pseudomonas aeruginosa:

It is a part of the normal gut flora. Carriage rates are low in the general population when compared to hospital inpatients, especially immunocompromised hosts. ^[3] Transmission is mainly through an exogenous source by direct/indirect contact with the environment.

Infections caused may be differentiated into

1.Community-acquired infections:folliculitis,otitis externa,ocular infections following trauma,osteomyelitis following trauma,endocarditis in intravenous drug abusers and respiratory tract infections in patients with cystic fibrosis^[20]

(14)

2. Hospital acquired infections: Infections of respiratory tract, urinary tract,wounds infections, bacteremia and rarely central nervous system infections^[20]

Pseudomonas aeruginosa strains has a propensity to develop resistance during therapy especially to carbapenems.The most common mechanism of imipenem resistance is a combination of chromosomal AmpC production and porin change. AmpC enzymes overproduction together with reduced outer membrane porin permeability and/or efflux pump overexpression contribute to high- level carbapenem resistance^[32].

Pseudomanas aeruginosa can harbor other antibiotic resistance enzymes such as K. pneumoniae carbapenemases (KPC), VIM encoded by blaVIM, and imipenem metallo- -lactamases. The combination of these enzymes leads to high rates of carbapenem resistance.

6. Enterobacter spp.

They cause opportunistic infections in immunocompromised and hospitalized patients and posses a wide range of antibiotic resistance mechanisms. Infections caused by Enterobacter species include a wide variety of hospital acquired infections of the respiratory tract, urinary tract, blood. ^[20]

Many Enterobacter strains contain ESBLs and carbapenemases, including VIM, OXA,metallo- -lactamase-1, and KPC and Amp-C -lactamases.

(15)

TABLE 2: METHODS FOR TESTING OF DRUG RESISTANCE ^[33]

SNO. ORGANISM

DRUG RESISTANCE

TESTED

SCREENING TEST

PHENOTYPIC CONFIRMATOR

Y TEST 1 Enterococcus

species

Vancomycin resistance

Disk diffusion method

MIC-microbroth dilution method 2A Staphylococcus

aureus Methicillin resistance Disk diffusion method 2B Staphylococcus

aureus

Vancomycin resistance

MIC-microbroth dilution method

MIC-microbroth dilution method 3A Klebsiella

pneumoniae ESBL production Disk diffusion method

Combination disc testing(Standard Disk diffusion method) 3B Klebsiella

pneumoniae MBL production Combination disc testing (Standard Disk diffusion method)

3C Klebsiella pneumoniae

Amp-C beta

lactamase production

Standard Disk diffusion method

Zone enhancement with phenyl boronic acid(PBA)

impregnated cefoxitin disc (Disk diffusion method) 3D Klebsiella

pneumoniae

Carbapenemases production

Modified Hodge Test

3E Klebsiella pneumoniae

Klebsiellapneumonia e

carbapenemases(KP C) production

Zone enhancement with phenyl boronic acid(PBA) impregnated meropenem disc(Standard Disk diffusion method) 4A Acinetobacter

baumannii

Amp-C beta

impregnated cefoxitin disc (Standard Disk diffusion method) 4B Acinetobacter

baumannii

Carbapenemase production

Modified Hodge Test

5A Pseudomonas aeruginosa

Amp-C beta

impregnated cefoxitin disc (Standard Disk diffusion method) 5B Pseudomonas

aeruginosa

MBL production Standard Disk diffusion method

Zone enhancement with EDTA impregnated Imipenem disc(

Standard Disk diffusion method) 5C Pseudomonas

aeruginosa

Carbapenemase production

Modified Hodge Test

(16)

SNO. ORGANISM

DRUG RESISTANCE

TESTED

SCREENING TEST

PHENOTYPIC CONFIRMATOR

Y TEST 6A Enterobacter spp Amp-C beta

impregnated cefoxitin disc (Standard Disk diffusion method) 6B Enterobacter spp Carbapenemase

production

Modified Hodge Test

TREATMENT OPTIONS FOR RESISTANT ORGANISMS 1. Vancomycin Resistant Enterococcus Species ^[22]

Foci of infection that are amenable to drainage should be drained, and infected foreign bodies, such as central venous catheters, must be removed.

For infections caused by VRE due to VanA gene , there is no current therapy that consistently provides bactericidal activity. Combination drug therapy involving cell wall–active agents, quinolones, aminoglycosides,tetracyclines, and rifampin, have been advocated.

For infections caused by ampicillin-susceptible VRE (E.faecalis), ampicillin is the drug of first choice. Antibiotics that have activity against VRE includes chloramphenicol, quinolones, tetracyclines, rifampicin, nitrofurantoin and fosfomycin. ^[22]

Newer drugs

 Quinupristin-dalfopristin is a parenteral combination of 2 streptogramins streptogramin A (70% dalfopristin) and B (30%

quinupristin)

(17)

These agents work synergistically to inhibit protein synthesis through the 50S ribosomal subunit thereby causing bacteriostatic effect.

This has activity against VRE -E. faecium, but has poor activity against E. faecalis.The combination of ampicillin with quinupristin-dalfopristin provides antimicrobial activity against E. faecalis alone. Common adverse effects include venous phlebitis and arthralgia or myalgia.

 Linezolid-This is the recently FDA approved oxazolidinone group of antibiotic available in both parenteral and oral formulations used to treat Urinary tract infections and Bacteremia.

They act by inhibiting the protein synthesis through the 30S ribosome initiation complex thereby causing bacteriostatic effect. Doesn’t exhibit cross resistance against the available agents for treatment of VRE infections.

Linezolid has uniform activity against all Enterococcus species. May cause myelosuppression. Few strains of Linezolid resistance has been reported due to inadvertent usage..

 Daptomycin-This is a lipopeptide antibiotic that act by inhibiting cell wall synthesis which has bactericidal effect used to treat Skin and soft tissue infection.This antibiotic exhibits activity against Van-B VRE.

Other drugs active against VRE include LY333328,, glycylcyclines (tigecycline), ketolides (telithromycin), lipoglycopeptides (Oritavancin, telavancin and dalbavancin)

(18)

VanC enterococci (E. gallinarum and E. casseliflavus) are relatively uncommon pathogens, typically susceptible to penicillins and other drugs and consequently are less difficult to treat.

2. Methiciilin Resistant Staphylococcus aureus^[34]

 Glycopeptide antibiotics:Vancomycin and Teicoplanin is the drug of choice for the treatment of established MRSA infections. These are bactericidal drugs. Teicoplanin has greater lipophilicity than vancomycin, long elimination half life, slow release from tissues, water solubility at physiological pH, and few inactive metabolites.

 They act by inhibiting synthesis and assembly of the second stage of cell wall peptidoglycan polymers by complexing with the D-alanyl-D- alanine portion of peptide precursor units, which fits into a “pocket” in the vancomycin molecule, thereby preventing its binding to peptidoglycan terminus that is the target of transglycolase and transpeptidase enzymes. They also act by altering the permeability of their cytoplasmic membrane and selectively inhibiting RNA synthesis.

 Other drugs - Linezolid, Quinupristin/dalfopristin, Cotrimoxazole, Clindamycin, Erythromycin, Rifampicin^[27]

 Drugs under Investigation- LY333328 (glycopeptide), SCH27899, and newer semisynthetic tetracyclines (glycylcylines).

 Linezolid,Quinupristin/Dalfopristi and Rifampicin are used for the treatment of VISA and VRSA infections.

(19)

3. ESBL producing organisms ^[35]

 Carbapenems are considered the most reliable treatment for infections caused by ESBL-producing bacteria

 Non carbapenem treatment options which may prove useful for infections caused by ESBL producing organisms include nitrofurantoin, fosfomycin, amikacin, cefepime, and piperacillin/tazobactam.

 Other drugs under investigation-Ceftazidime /avibactum.^[35]

4. AmpC β lactamases producing organisms^[36]

 Strains with Amp-C genes are often resistant to multiple antibiotics.

βLactam/β-lactamase inhibitor combinations and most cephalosporins and penicillins are avoided because of in- vitro resistance.

 4^th generation cephalosporins mainly cefepime can be used because it is less hydrolysed by the enzyme.

 Temocillin,a 6-α-methoxy derivative of ticarcillin, is active against many AmpC-producing Enterobacteriaceae.

 Carbapenems can be used for treatment with a caution of emergence of carbapenemase resistance.

 Other drugs-Fluoroquinolones(if tested susceptible) and Tigecycline.

5. MBL/Carbapenemase producing organisms ^[37]

 In general combination of antibiotics are preferred over monotherapy to avoid emergence of resistance

 Antibiotics commonly used are Colistin, Tigecycline, fosfomycin, carbapenems(only as combination therapy), aminoglycosides(only as

(20)

combination therapy), Piperacillin tazobactam (only as combination therapy)

 Tigecycline-This drug is a glycycline agent available in parenteral formulations. It is a bacteriostatic drug.The major adverse effects are nausea,vomiting and diarrhoea.

 Polymyxins-Because of limited therapeutic options available to combat carbapenem reistance,polymyxins like polymyxin B and polymyxin E came to use. It has bactericidal activity and acts by increasing the cell permeability,ultimately leading to cell death .Major adverse effects include nephrotoxicity,neurotoxicity and pulmonary toxicity that has led to its limited use.

INFECTION CONTROL MEASURES ^[7]

Prevention of infections

Prevention of antimicrobial resistance depends on pertinent clinical practices that must be incorporated into routine patient care.

These practices include optimal management of vascular and urinary catheters, prevention of lower respiratory tract infection in intubated patients, accurate diagnosis of infectious etiologies, and judicious antimicrobial selection and utilization.

Control Interventions

Various interventions are applied to control and eradicate MDRs 1. Administrative support and involvement

(21)

2. Health Education- Facility-wide, unit-targeted educational interventions must be advocated to encourage a behavioral change through improved understanding of the problem.

3. Judicial use of antibiotics(Antibiotic stewardship)-Main focus should be on effective antimicrobial treatment of infections, use of narrow spectrum antimicrobial agents, avoiding excessive duration of therapy and restricting use of broad-spectrum or more potent antimicrobials to treat serious infections when the pathogen is not known or when other effective agents are unavailable.

4. Surveillance- Surveillance allows the detection of newly emerging pathogens, monitoring epidemiologic trends, and measuring the effectiveness of interventions.

5. Infection Control Precautions- Standard Precautions have an important role in prevention of MDR transmission.

 Hand hygiene.

 Isolation practices and cohorting of patients and health care professionals during outbreaks.

 Contact barrier precaution to health care professionals.

 Point source control and clinical unit closure during an outbreak to interrupt transmission and thorough environmental disinfection.

6. Decolonization- Decolonization entails treatment of persons usually colonized with MRSA and VRE, to eliminate carriage. The use of decolonization procedures is limited to outbreaks, or other high prevalence situations, such as those affecting special-care units.

(22)

MATERIALS AND METHODS Place of study

The present study was carried out in the Institute of Microbiology, Madras Medical College, in association with Medical,Surgical and Trauma Intensive Care Unit, RGGGH,Chennai.

Study Period

Duration of study was one year Ethical consideration

Approval from the Institutional Ethics committee was obtained before commencement of the study. Informed consent was obtained from all the patients who participated in the study.

Statistical analysis-Statistical analysis were carried out using Statistical Package for Social Sciences(SPSS).The proportional data of this cross sectional study were arrived using Pearson’s Chi Analysis Test.

Study Population

A total of 400 consecutive, non duplicate samples were enrolled in the study.The isolates were from various clinical specimens which were sent to the Microbiology Laboratory for bacteriological culture and antibiotic susceptibility testing. Isolates included in this study were obtained from blood, sputum,endotracheal aspirate, bronchial wash, pleural fluid, ascitic fluid, cerebrospinal fluid, urine and wound swabs.

(23)

Inclusion criteria

 Patients aged above 18 years

 Intensive Care Unit patients with clinical diagnosis of Urinary tract infections, Blood stream infections , Lower respiratory tract infections

& Other infections.

Exclusion criteria

 Subsequent samples from the same patient and duplicated were excluded in the study.

 Patients aged less than18 years.

Collection of data

Data was collected from patients who satisfied the inclusion criteria. A detailed history regarding name, age, gender, presenting complaints, previous infections, antibiotic intake during previous episodes, associated co-morbid conditions like Diabetes mellitus, Prolonged steroid therapy and any factors influencing immune suppression.

4.1 SPECIMEN PROCESSING

The clinical specimens which were collected from patients admitted in the ICU’s were processed as per standard guidelines using appropriate culture media and incubation conditions. Significant isolates were identified phenotypically and those belonging to ESKAPE group were further studied.

(24)

4.2 IDENTIFICATION

The bacterial isolates were identified based on the following identification tests

Staphylococcus aureus-^[38]

1. Colony morphology–On 5% Blood Agar Plate(BAP)- White opaque colonies with a Zone of β-hemolysis.

On Nutrient Agar plate- Small golden yellow non diffusible pigment producing colonies.

On MacConkey agar(MAC)-Small Lactose Fermenting opaque colonies.

2. Gram staining showed Gram positive cocci in clusters.

3. Colonies were subjected to the following Identification tests. ^[38]

S.NO TESTS RESULTS

1. Catalase test Positive

2. Coagulase test( Slide and Tube method) Positive

3. Urease test Positive

4. Hugh-Leifson’s Oxidation Fermentation test Fermentative pattern

5. Mannitol fermentation test Fermented with gas

production

Enterococcus faecalis^[38]

1. Colony morphology –On 5% Blood Agar Plate(BAP) - Tiny Translucent non -haemolytic colonies . On MacConkey agar(MAC)-Small Magenta pink (Lactose Fermenting )colonies.

(25)

2. Gram staining showed Gram positive oval cocci in pairs and short chains.

3. Colonies were subjected to the following Identification tests.^[38]

1. Catalase test Negative

2. Heat tolerance test at 60ºC Positive 3. Growth in 6.5% Sodium chloride Positive 4. Bile esculin hydrolysis Positive 5. Arginine dihydrolase test Hydrolysed 6. Arabinose Fermentation Test Not fermented

Klebsiella pneumoniae^[38]

1. Colony morphology – On MacConkey agar(MAC)-Large mucoid Lactose fermenting colonies.

2. Gram staining showed Short plump Gram negative bacilli.

3. Motility test by Hanging Drop method-Non-Motile.

1. Catalase Positive

2. Oxidase Negative

3 Nitrate Reduction test Positive

4. Hugh-Leifson’s Oxidation Fermentation test Fermentative

5. Indole test Negative

(26)

6. Methyl Red test(MR), Voges-Proskauer test(VP) MR:Negative ; VP:

Positive 7. Simmon’sCitrate Utilization test Positive

8. Christensen’s Urease test Positive

9. Triple Sugar Iron agar test(TSI)

Acid butt/acid slant with gas production and no H2S production

10. Lysine Decarboxylation test Positive

11 Ornithine Decarboxylation test Negative

Acinetobacter baumannii

1. Colony morphology – On MacConkey agar(MAC)-Large Lactose non- fermenting pale pink colonies.

2. Gram staining showed Gram negative cocco- bacilli.

3. Motility test by Hanging Drop method-Non-Motile.

2. Oxidase Negative

3 Nitrate Reduction test Negative

4. Hugh-Leifson’s Oxidation Fermentation test Oxidative

(27)

6. Simmon’sCitrate Utilization test Positive

7. Christensen’s Urease test Negative

8. Triple Sugar Iron agar test(TSI) Alkaline slant/alkaline butt

9. Growth at 42ºC Positive

10. 10% OF Lactose Utilization test Positive

Pseudomonas aeruginosa^.[38]

1. Colony morphology – On MacConkey agar(MAC)-Large spreading Lactose non- fermenting colonies.

On Nutrient Agar plate-Irregular colonies with metallic sheen and blue green diffusible pigment.

2. Gram staining showed Gram negative slender bacilli.

3. Motility test by Hanging Drop method-Motile.

2. Oxidase Positive

4. Hugh-Leifson’s Oxidation Fermentation test Oxidative

7. Simmon’s Citrate Utilization test Positive

(28)

Alkaline slant/alkaline butt without gas or H₂S production 10. Arginine Dihydrolase test Positive

11. Nitrate Reduction test Positive

12. Growth at 42ºC Positive

Enterobacter species-^[38]

1. Colony morphology–OnMacConkey agar(MAC)-Large,mucoidLactose fermenting colonies.

2. Gram staining showed Gram negative bacilli.

3. Motility test by Hanging Drop method-Motile.

2. Oxidase Negative

4. Hugh-Leifson’s Oxidation Fermentation test Fermentative

6. Methyl Red test(MR), VogesProskauer

test(VP) MR:Negative ; VP: Positive

7. Simmon’sCitrate Utilization test Positive

(29)

Acid slant/acid butt with gas production and no H2S production

10. Lysine Decarboxylation test

Positive in E.aerogenes Negative in E.cloacae 11 Arginine dihydrolase test

Positive in E.cloacae Negative in E.aerogenes 12. Ornithine Decarboxylation test Positive

4.3 ANTIBIOTIC SUSCEPTIBILITY TESTING 4.3.1Disc Diffusion Method

 Antibiotic Susceptibility testing of the isolated organisms was done on Mueller Hinton Agar(MHA) plates by Kirby Bauer disc diffusion method as per CLSI document M100-S26. ^[33] The antibiotic discs were obtained from HiMedia Laboratories Private limited, Mumbai.

Inoculum preparation

 Three to five well isolated colonies from pure growth of test organism were selected from the 5% sheep BAP or MacConkey agar plate , top of each colony was touched with a bacteriological loop and inoculated into 4-5 ml of nutrient broth. The broth culture was incubated at 35°C for 2 hours. The turbidity of broth culture was adjusted with nutrient broth to obtain turbidity optically comparable to that of the 0.5 McFarland standard.

(30)

 A sterile cotton swab was dipped into the adjusted suspension. The dried surface of a MHA plate was inoculated by streaking the swab over the entire sterile agar surface. Five antibiotic discs were placed per plate 24 mm apart from center to center and incubated aerobically for 24 hours at 37°C.

 The diameter of the zone of inhibition was measured and recorded in millimeters and was then compared with zone diameter interpretative standards chart of the CLSI document M 100-S26.^[33] The quality control for antimicrobial susceptibility testing was done with the following standard strains; Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 29212, Pseudomonas aeruginosa ATCC 27853.

Zone Diameter Interpretive Standards for Staphylococcus species^[33]

Antimicrobial Agent

Disc content

Zone Diameter Interpretive Criteria (nearest whole mm)

Sensitive Intermediate Resistant

Penicillin 10 units ≥ 29 - ≤ 28

Trimethoprim/

Sulfamethoxazole

1.25/23.75

µg ≥16 11-15 ≤ 10

Tetracycline 30 µg ≥19 15-18 ≤ 14

Ciprofloxacin 5 µg ≥21 16-20 ≤ 15

Amikacin 30 µg ≥17 15-16 ≤14

Chloramphenicol 30 µg ≥18 13-17 ≤12

Linezolid 30 µg ≥23 - ≤ 20

Rifampicin 5 µg ≥20 17-19 ≤16

(31)

Zone Diameter Interpretive Standards for Enterococcus faecalis^[33]

Antimicrobial

Agent Disc content

Zone Diameter Interpretive Criteria (nearest whole mm)

Sensitive Intermediate Resistant

Penicillin 10 units ≥ 15 - ≤ 14

Norfloxacin 5 µg ≥17 13-16 ≤ 12

Nitrofurantoin 300 µg ≥17 15-16 ≤ 14

Chloramphenicol 30 µg ≥18 13-17 ≤12

Vancomycin 30 µg ≥17 15-16 ≤ 14

Linezolid 30 µg ≥23 21-22 ≤ 20

Rifampicin 5 µg ≥20 17-19 ≤16

High level

Gentamicin 120 µg ≥10 7-9 ≤ 6

Zone Diameter Interpretive Standards for Enterobacteriaceae^[33]

Disc content

Amikacin 10 µg ≥ 17 15-16 ≤ 14

Trimethoprim/

Sulfamethoxazole

1.25/

23.75 µg ≥16 11-15 ≤ 10

Cefotaxime 30 µg

≥26 23-25 ≤ 22

(32)

Ceftazidime 30 µg ≥21 18-20 ≤ 17

Norfloxacin 5 µg ≥17 13-16 ≤ 12

Nitrofurantoin 300 µg ≥17 15-16 ≤ 14

Amoxicillin- Clavulanate

20/10 µg ≥18 14-17 ≤ 13

Piperacillin- Tazobactam

100/

10 µg ≥21 18-20 ≤ 17

Imipenem 10 µg ≥23 20-22 ≤ 19

Zone Diameter Interpretive Standards for Gram Negative Non-Fermenter Bacteria^[33]

Gram Negative Bacilli

Sensitive Intermediate Resistant

Amikacin 10 µg

Pseudomonas aeruginosa and Acinetobacter baumannii

≥ 17 15-16 ≤ 14

Gentamicin 10 µg

Pseudomonas aeruginosaand Acinetobacter baumannii

≥15 13-14 ≤ 12

Trimethoprim/

Sulfamethoxaz ole

1.25/

23.75 µg

Acinetobacter

baumannii ≥16 11-15 ≤ 10

Ciprofloxacin 5 µg

≥21 16-20 ≤ 15

(33)

Gram Negative Bacilli

Sensitive Intermediate Resistant Cefotaxime 30 µg Acinetobacter

baumannii ≥23 15-22 ≤ 14

Ceftazidime 30 µg

≥18 15-17 ≤ 14

Tetracycline 30 µg Acinetobacter

baumannii ≥15 12-14 ≤ 11

Norfloxacin 5 µg Pseudomonas

aeruginosa ≥17 13-16 ≤ 12

Piperacillin- Tazobactam

100/

10 µg

Acinetobacter

baumannii ≥21 18-20 ≤ 17

Pseudomonas

aeruginosa ≥21 15-20 ≤ 14

Imipenem 10 µg

Pseudomonas

aeruginosa ≥19 16-18 ≤ 15

Acinetobacter

baumannii ≥22 19-21 ≤ 18

Colistin 10 µg Pseudomonas

aeruginosa ≥11 - ≤10

Polymyxin B 300 units

Pseudomonas

aeruginosa ≥12 - ≤11

44.3.2 Determination of Minimum inhibitory concentration (MIC) for Vancomycin for Staphylococcus aureus and Enterococcus faecalis by Broth Microdilution Method^[39]

1. Culture media: Cation Adjusted Mueller Hinton Broth(pH7.2-7.4) 2. Preparation of antibiotic stock solution^[39]

(34)

Vancomycin used for preparing stock solution was obtained from HiMedia Laboratories Private limited, Mumbai.

Formula: W =1000 xV x C P Where ,

P= Potency of the antibiotic in relation to base (For Vancomycin,P= 950 μg/1000mg),

V= Volume of the stock solution to be prepared( 10 mL), C = Final concentration of solution 1024 μg/ml,

W = Weight of antibiotic in mg to be dissolved in volume V (mL).

10.77 mg of the drug was mixed with 10 ml of distilled water which contains 1024µg /ml concentration of drug.

3. Preparation of antibiotic dilutions:

1. 98 well flat bottomed microtitre plate was used

2. Using micropipette 100µL of MH broth was transferred to all the wells.

3. From the stock solution 100 µL was transferred to first well in each row and mixed well.

4. From the first well 100µl of antibiotic solution was added to well labelled 128 μg/ml with a micropipette then 100µl was transferred from 128 μg/ml tube to 64μg/ml tube, similarly serial dilution was done till the last tube labelled 0.0625 μg/ml and 100µl was discarded from the last well.

5. One well containing only antibiotic solution was kept as drug control.

(35)

4. Inoculum preparation for the test and ATCC control:

1. 9.9ml of MH broth was taken in a sterile test tube.

2. 0.1ml of 0.5 McFarland turbidity matched test organism was added to broth and mixed well.

3. From the above inoculum10µl was transferred tomicrotitre well containing antibiotic dilutions which were labelled as 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125,0.0625 μg/ml.

Same procedure was followed for the control organisms Staphylococcus aureus ATCC25923 and Enterococcus faecalis ATCC 29212.

5. Incubation : 37ºC overnight.

6. Interpretation:

 The MIC end point was read as the lowest concentration of the antibiotic at which there was no visible growth.

 The MIC of control strain was observed, which was within sensitive range, hence the test was considered to be valid.

Minimum inhibitory concentration (MIC) interpretive standards of Vancomycin for Staphylococcus aureus.^[33]

Organism

MIC Interpretive Criteria (µg/ml)

Staphylococcus aureus ≤ 2 4-8 ≥ 16

(36)

Minimum inhibitory concentration (MIC) interpretive standards of Vancomycin for Enterococcus faecalis^[33].

Organism

MIC Interpretive Criteria (µg/ml)

Enterococcus faecalis ≤ 4 8-16 ≥ 32

4.4 DETECTION OF ANTIMICROBIAL RESISTANCE MECHANISMS Tests were performed for detection of the following antimicrobial resistance pattern

1. Detection of Vancomycin resistant Enterococcus species(screening &

phenotypic confirmatory tests).

2. Detection of Methicillin resistant Staphylococcus aureus(screening &

3. Detection of Extended Spectrum β Lactamase production(screening &

4. Detection of Metallo- β- lactamases(screening & phenotypic confirmatory tests).

5. Detection of Amp-C beta lactamase producers(screening & phenotypic confirmatory tests).

6. Detection of ESBL and Amp-C beta lactamase co- producers(screening &

phenotypic confirmatory tests)

7. Detection of carbapenemase producers(screening & phenotypic confirmatory tests).

(37)

8. Detection of Klebsiella pneumoniae carbapenemase(screening &

4.4.1.Detection of vancomycin resistance in Enterococcus faecalis:

4.4.1AScreening test(Standard disc diffusion method):

Procedure:Inoculum of Enterococcus faecalis was prepared in nutrient broth by direct colony suspension from a nonselective agar(BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 30µg vancomycin disc was placed in the agar plate and incubated at 37ºC for 16-20 hours.Enterococcus faecalis ATCC 29212 was used as quality control strain

Interpretation: Zone size ≤14mm may indicate vancomycin resistance.^[33]

4.4.1BPhenotypic Confirmatory test:

All Enterococcus faecalis isolates suspected to be vancomycin resistant in the screening test were further confirmed as per the CLSI guidelines by determining Minimum inhibitory concentration by Microbroth dilution method.

Interpretation:^{33}

MIC Interpretive Criteria (µg/ml)

≤ 4 8-16 ≥ 32

(38)

4.4.2 Testing of antimicrobial resistance inStaphylococcus aureus 4.4.2A Detection of Methicillin resistance:

Screening test and Phenotypic Confirmatory test (Standard disc diffusion method)

Inoculum of Staphylococcus aureus was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 30µg cefoxitin disc was placed in the agar plate and incubated at 35ºC for 16-20 hours.Staphylococcus aureus ATCC 25923 was used as quality control strain

Interpretation^[33]: Zone size ≤21mm were considered as methicillin resistant.

4.4.2B Detection of Vancomycin resistance:

All Staphylococcal aureus isolates were tested for vancomycin resistance as per the CLSI guidelines by determining Minimum inhibitory concentration by Microbroth dilution method.

Interpretation:

MIC Interpretive Criteria (µg/ml)

≤ 2 4-8 ≥ 16

4.4.3 Detection of Extended Spectrum Beta-Lactamase production(ESBL) 4.4.3A Screening test(Standard disc diffusion method)

Isolates of Klebsiella species ,Escherichia coli and Proteus mirabilis were tested for ESBL production.

(39)

Procedure:

Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 30µg cefotaxime disc and 30µg ceftazidime disc was placed in the agar plate and incubated at 37ºC for 16-20 hours.

Interpretation:

Isolates with zone size of ≤ 27 mm for Cefotaxime and ≤ 22 mm for Ceftazidime were suspected to be ESBL producers.^[33]

4.4.3B Phenotypic Confirmatory test (Standard disc diffusion method):

Procedure:

All isolates suspected to be ESBL producers by screening test were confirmed by phenotypic confirmatory test. Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 30µg cefotaxime disc and Cefotaxime-clavulanic acid (30/10μg) disc were placed at a distance of24 mm and 30µg Ceftazidime and Ceftazidime-clavulanic acid (30/10μg) disc were placed at a distance of 24 mm centre to centreand incubated at 37ºC for 16-20 hours.^[33]

Interpretation:

A ≥ 5mm increase in zone diameter for either antimicrobial agent tested in combination with clavulanic acid versus the zone diameter of the agent when

(40)

tested alone signified a ESBL producer. Escherichia coli ATCC 25922 was used as the quality control strain.^[33]

4.4. 4 Detection of the Metallo- β- lactamases (MBL) 4.4.4A Screening test (Standard disc diffusion method)

All Gram negative bacterial isolates were screened for MBL production.

Procedure:

Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 10µg Imipenem disc was placed in the agar plate and incubated at 37ºC for 16- 20 hours.^[33]

Interpretation:

For Enterobacteriaceae

Zone size of ≤ 19 may indicate MBL production.

For Acinetobacter baumannii

Zone size of ≤18 may indicate MBL production.

For Pseudomonas aeruginosa

Zone size of ≤15 may indicate MBL production.

All isolates suspected to be MBL producers by screening test were confirmed by phenotypic confirmatory test. Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5

(41)

McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate.

A 10µg Imipenem disc and Imipenem – Ethylene Diamine TetraAcetic acid (IPM+ EDTA) (30/750μg) disc were placed at a distance of 25 mm centre to centre and incubated at 37ºC for 16-20 hours.^[40]

Interpretation:

A ≥ 5-mm increase in zone diameter for either antimicrobial agent tested in combination with EDTA versus the zone diameter of the agent when tested alone signified a MBL producer.

4.4.5 Detection of Amp-C beta lactamase producers

All Gram negative bacterial isolates were screened for Amp-C beta lactamase production.

4.4.5A Screening test (Standard disc diffusion method):

Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar(BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate . A 30µg cefoxitin disc was placed in the agar plate and incubated at 37ºC for 16- 20 hours.

Interpretation:

Zone size ≤18 mm were suspected as Amp-Cbeta lactamase producers.

(42)

All isolates suspected to be Amp-C beta lactamase producers by screening test were confirmed by phenotypic confirmatory test. Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. Two30µg cefoxitin disc were placed at a distance of 24 mm centre to centre and 10µl of 40mg/ml solution Phenyl Boronic Acid(PBA)was added to one of them to obtain a desired concentration of 400µg.,and incubated at 37ºC for 16-20 hours.^[41]

Interpretation:

A ≥ 5-mm increase in zone diameter for either antimicrobial agent tested in combination with PBA versus the zone diameter of the agent when tested alone signified a Amp-C beta lactamase producer.^[41]

4.4.6 Detection of ESBL and Amp-C beta lactamase co- producers

All isolates which were Amp-C beta lactamase producers, were tested for ESBL and Amp-C beta lactamase co- producers. Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 30µg cefepime disc and Piperacillin- Tazobactam disc (100/10μg) disc were placed at a distance of 25mmcentre to centre and incubated at 37ºC for 16-20 hours.^[42]

(43)

Interpretation:

A ≥ 5-mm increase in zone diameter for Piperacillin-Tazobactam disc versus the zone of Cefepime disc, signified a ESBL and Amp-C beta lactamase producer.^[42]

4.4.7 Detection of carbapenemase producers

All Gram negative bacterial isolates were screened for Carbapenemase production

4.4.7A Screening test (Standard disc diffusion method):

Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 10µg Ertapenem disc was placed in the agar plate and incubated at 37ºC for 16- 20 hours.^[33]

Interpretation:

For Enterobacteriaceae

Zone size of ≤ 19 may indicate Carbapenemase production.

For Acinetobacter baumannii

Zone size of ≤14 may indicate Carbapenemase production.

For Pseudomonas aeruginosa

Zone size of ≤15 may indicate Carbapenemase production.

(44)

4.4.7B Phenotypic Confirmatory test-Modified Hodge Test^[33]

Procedure:

 A 0.5 McFarland standard suspension of E.coli ATCC25922 was prepared in broth or saline and diluted to 1:10 in saline or broth and inoculated onto MHA plate as for the routine disc diffusion procedure. The plate was allowed to dry for 3-10 minutes, then10 µg Ertapenem disc was placed in the centre of the plate. In a straight line, test organism was streaked from edge of the disc to the edge of the plate and incubated at 37ºC for 16- 20hrs.^[33]

Interpretation:

Enhanced growth around the test organism streak at the intersection of the streak and the zone of inhibition around the test (clover leaf indentation) was considered as positive, i.e carbapenemase producer.^[33]

4.4.8 Detection of Klebsiella pneumoniae carbapenemases (KPC)

All Gram negative bacterial isolates were screened for KPC production.

4.4.8A Screening test(Standard disc diffusion method) Procedure:

Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. A 10µg Ertapenem disc was placed in the agar plate and incubated at 37ºC for 16-20 hours.^[43]

(45)

Interpretation:

Zone size of ≤ 18 may indicate Klebsiella pneumoniae carbapenemase production.^[43]

4.4.8B Phenotypic confirmatory test(Standard disc diffusion method) Procedure:

All isolates suspected to be Klebsiella pneumoniae carbapenemase producers by screening test were confirmed by phenotypic confirmatory test.

Inoculum was prepared in nutrient broth by direct colony suspension from a nonselective agar (BAP) to obtain 0.5 McFarland turbidity. A swab dipped in the suspension was streaked in three dimensions in MHA plate. Two 10µg Ertapenem discwere placed at a distance of 24 mm centre to centre and 10µl of 40mg/ml solution phenyl boronic acid was added to one of them to obtain a desired concentration of 400µg.,and incubated at 37ºC for 16-20 hours.^[43]

Interpretation:

A ≥ 5-mm increase in zone diameter for either antimicrobial agent tested in combination with Phenyl Boronic Acid versus the zone diameter of the agent when tested alone signified a Klebsiella pneumoniae carbapenemase producer.

[43]

4.5MOLECULAR METHOD[Conventional Polymerase Chain Reaction(PCR)]:

4.5.1Materials required:

(46)

1. Bacterial DNA minispin purification kit containing Lysozyme, Lysozyme digestion buffer, Proteinase-K, Binding buffer, Wash Buffer-1, Wash Buffer-2, Spin columnswith collection tube and elution buffer.

2. 2X ReDdyePCR Master Mix containing 2U of Taq DNA polymerase, 10X Taq reaction buffer, 2mM MgCl2, 1μl of 10mM dNTPs(Deoxyribose containing nucleoside triphosphate) mix and RedDye PCR additives.

3. Agarose gelelectrophoresis consumables [Agarose, 50X TAE (Trisbase Acetic acid and EDTA buffer), 6X gel loading buffer and Ethidium bromide]

4. MecA Primers as designed by HELINI Biomolecules, Chennai,India.

Forward Primer: GCAATCGCTAAAGAACTAAG Reverse Primer: GGGACCAACATAACCTAATA 4.5.2 Procedure:

Bacterial DNA Purification

1. 1ml of overnight culture was centrifuged at 6000rpm for 5min

2. Supernatant was discarded and Pellet suspended in 0.2ml Phosphate Buffer Saline(PBS).

3. 180μl of Lysozyme digestion buffer and 20μl of Lysozyme [10mg/ml] was added and incubated at 37ºC for 15min.

4. 400μl of Binding buffer, 5μl of internal control template and 20μl of Proteinase K was added and mixed well by inverting several times and incubated at 56ºC for 15min.

5. 300μl of Ethanol was added and mixed well.