Analysis of genetic diversity in high biomass producing sugarcane hybrids (Saccharum spp. complex) using RAPD and STMS markers
K Saravanakumar, P Govindaraj, C Appunu*, S Senthilkumar and Ravinder Kumar Division of Crop Improvement, Sugarcane Breeding Institute (ICAR), Coimbatore 641 007, India
Received 16 January 2013; revised 6 April 2013; accepted 12 May 2013
RAPD and STMS primers (15 of each) were employed to reveal genetic diversity among 23 high biomass producing sugarcane hybrids (Saccharum spp. complex). These high biomass hybrids were derived from Saccharum gene pool that consist of commercial hybrids (Co canes), genetic stocks with special characters, interspecific and intergeneric hybrids, and multi species hybrids. RAPD primers generated 221 amplicons, of which 162 amplicons (~73.3%) were polymorphic and 3 amplicons were specific to genotype. STMS polymorphic primer pairs generated 214 amplicons with an average of 11.9 polymorphic amplicons per primer pair. Six hybrids were identified by 12 unique STMS markers. Polymorphic information content (PIC) varied from 0.121 to 0.631, with an average of 0.447, and 0.195 to 0.663, with an average of 0.526, for RAPD and STMS markers, respectively. The genetic similarity between cultivars varied from 0.542 to 0.844 for RAPD and 0.478 to 0.874 for STMS markers. The average genetic similarity among the hybrids was 72% for RAPD and 73% for STMS. Dendrogram generated based on RAPD and STMS markers data grouped all the clones into three and six clusters, respectively. This study shows STMS markers as a good tool to discriminate genotypes of high biomass sugarcane hybrids with unique DNA fingerprints.
Keywords: Genetic diversity, high biomass sugarcane, PIC, RAPD, STMS
Introduction
Sugarcane (Saccharum spp.) is an important commercial crop in the Asia, Africa, Australia, and America. It is a versatile crop with diverse uses as food, feed and fodder. It is the major source of sugar (~75%) globally and primary raw material for all major sweeteners produced as well as raw material for an array of industrial products. In India, sugarcane is the second most important agro-industrial crop and it supports two important sweetener cottage industries, viz., Gur (Jaggery) and Khandsari, which together produce about 10 million tonne of sweeteners (gur and khandsari sugar) per annum from 28-35% of the cane produced in the country. It is grown in about 5.06 million hectare with an annual cane production of 338.9 million tonne1.
Genetic manipulation of sugarcane since 1912 has led to the development of several high sucrose and high-yielding hybrids. Moreover, sugarcane has also been identified as a potential source for cogeneration of power and bio-fuels2. The solid waste that is left after extraction of the sugar, known as pulp or sugarcane
bagasse, is dried and used as fuel and renewable resource in manufacturing of paper products and building materials. Bagasse is often used as a primary fuel source for sugar mills and its secondary feed stock in cogeneration of power. To support cogeneration of power and ethanol production, there is a need to develop hybrids (energy canes) which are capable of producing high biomass with higher fibre and higher total sugars content. In addition, hybrids must be suitable for submarginal lands and less irrigated conditions, and amenable for multiple ratooning and early harvest (8 months). Sugarcane Breeding Institute (SBI), Coimbatore has initiated the development of such energy cane and identified promising potential clones from the available sugarcane germplasm for further evaluation and utilization.
Genetic resource characterization and assessment of diversity is a basic necessity for efficient management and utilization of germplasm, and protection of related intellectual property rights.
Compared to morpho-biochemical markers, molecular markers detect more variation, unaffected by genotype (G)-environment (E) interaction, and simply inherited.
Among DNA based markers, markers like RAPD and STMS are useful for molecular characterization as these do not require prior information of the target
_____________
*Author for correspondence:
Tel: +91-422-2476260; Fax: +91-422-2472913 E-mail: cappunu@gmail.com
genome. RAPD banding patterns usually represent the entire genome, whereas the STMS patterns are generated from the microsatellite regions only. Thus, the two methods have different genome coverage and a collective analysis of data by the two methods together would result in a comprehensive comparison of the genotypes under study. The combination of these markers has been prudently used to reveal the unbiased estimate of genetic relatedness among individuals3. In the present study, molecular fingerprints of 23 high biomass producing sugarcane hybrids were developed using RAPD and STMS markers to assess their genetic diversity and relatedness.
Materials and Methods
Plant Materials
Genetically pure materials of these hybrids were collected from the germplasms maintained at Sugarcane Breeding Institute, Coimbatore. The pedigree of these hybrids is listed in Table 1.
DNA Isolation
The method of Doyle and Doyle4 was followed for genomic DNA isolation from young leaves of late shoots, produced by mother plant of each genotype, and purified by RNase treatment. DNA concentration was quantified using a NanoDrop Spectrophotometer (ND-1000, version 3.1.1, USA). The DNA samples
were diluted to 20 ng µL-1 for polymerase chain reaction (PCR) amplification.
RAPD and STMS Analyses
The RAPD and STMS primers used in this study are given in Table 2. For RAPD analysis, PCR reactions were performed by following the procedure of Govindaraj et al5, in which 25 µL reaction mixture contained 1× PCR buffer, 0.5 units of Taq DNA polymerase, 1.5 mM MgCl2, 200 µM of each dNTPs, 0.2 µM primers and 2 µL (~40 ng) of genomic DNA.
The PCR reactions were carried out in Thermal Cycler (Eppendorf Master Cycler, Germany) that was programmed as follows: an initial DNA denaturation for 5 min at 94°C; 45 cycles of 1 min at 94°C (denaturation), 1 min at 36°C (primer annealing) and 2 min at 72°C (elongation); a final extension step at 72°C for 10 min.
For STMS analysis, PCR reactions were performed as that of the RAPD PCR except that the reaction performed in a 10 µL reaction mixture with 0.2 µM of both forward and reverse primers. The PCR reactions were carried out in Thermal Cycler using single primer pair in each reaction. The PCR cycle conditions used were as explained earlier6. The PCR reactions were repeated thrice for each primer to ensure the reproducibility of RAPD and STMS markers.
The RAPD amplified DNA fragment was analyzed by electrophoresis on 2% agarose gel in a 1× TBE buffer. The STMS amplified fragments were resolved on 8% polyacralamide gel. Ethidium bromide (0.5 µg mL-1) was used to stain the gels and DNA fragments were visualized under UV light.
Band Scoring and PIC Value Calculation
The DNA fragments that were amplified by a given primer or primer pair were scored as present (1) or absent (0) for all the samples that were studied. The clear and reproducible bands were scored for the data analysis, but major bands corresponding to reproducible faint bands were also included in the study. The polymorphism information content (PIC) value of individual primers or primer pairs was calculated by using PowerMarker version 3.25 (http://statgen.ncsu.edu/powermarker/).
Construction of Dendrogram
The Jaccard’s similarity index was calculated using NTSYS-pc software version 2.10 (Applied BioStatistics, Inc., Setauket, NY, USA) package to compute pairwise Jaccard’s similarity coefficients7. The similarity matrix was then used for cluster
Table 1—Origin and pedigrees of 23 high biomass producing sugarcane hybrids used for genetic diversity analysis
Hybrid Parentage
NCo 310 Co 421 × Co 312
CoPant 92226 Commercial cane × Commercial cane 97 R 383 Commercial cane × Commercial cane 94 GUK 2437 Co 62175 × IK 76-91
SSEA (013502 )×
Co 62198
(Saccharum spontaneum × Erianthus)×
Co 02108
IGHENI 3 Erianthus × N1 nobilised cane IGHENI 6 Erianthus × N1 nobilised cane SSCD 1875 Co cane × S. spontaneum SSCD 1006 Co cane × S. spontaneum SSCD 944 Co cane × S. spontaneum SSCD 849 Co cane × S. spontaneum
985401 931527 × Co 775
IA 3135 Co cane × S. spontaneum IA 1167 Co cane × S. spontaneum 94 GUK 2454 Co 62175 × IK 76-91
GUK 00-1226 Co 62175 × (CP52-68 × IK 76-91) ISH 07-1974 IJ 76-498 × IJ 76-208 & IJ 76-545 IGH 07-4249 04 (24) RE-150 × CoH 70 IGH 07-4263 04 (24) RE-150 × Co 775 Co 86032 Co 62198 × Co 6671 IGH 07-1828 04 (249) KE 473 × Co 775 ISH 01-2909 KRS (6) × N2S1O111 (SR SS SO) NG 77-18 S. officinarum
Table 2—RAPD and STMS primers used for assessing genetic diversity in high biomass producing sugarcane hybrids and level of polymorphism detected
Primer Primer sequence Repeat motif TB MB PB PP PIC Band size range
(5′-3′) (bp)
RAPD
OPG2 ggcactgagg 25 12 13 52.0 0.121 208-915
OPG3 gagccctcca 15 5 10 66.6 0.382 283-896
OPG4 agcgtgtctg 13 5 8 61.5 0.501 309-1146
OPG13 ctctccgcca 11 1 10 90.9 0.583 258-1073
OPG15 actgggactc 27 14 13 48.1 0.121 278-1015
OPG17 acgaccgaca 16 0 16 100 0.631 179-1362
OPJ9 tgagcctcac 18 5 13 72.2 0.382 313-1196
OPJ11 actcctgcga 20 1 19 95.0 0.592 106-1361
OPJ15 tgtagcaggg 9 2 7 77.8 0.412 267-1191
OPO16 tcggcggttc 9 0 9 100 0.623 332-1383
OPO18 ctcgctatcc 14 6 8 80.0 0.501 209-1046
OPO19 ggtgcacgtt 16 3 13 81.3 0.517 254-1328
OPV13 accccctgaa 8 0 8 100 0.612 314-1075
OPV14 agatcccgcc 8 2 6 75.0 0.412 367-1191
OPV16 acaccccaca 12 3 9 75.0 0.317 254-1128
221 59 162 73.3 0.447
STMS
NKS16 f-gacagaatatgccatggataacaa r- cgttctctggtcctattgagc
(ag)23 10 3 7 77.8 0.494 217-623
NKS21 f- taagccattgggaagaggtg r- ctgatgcctgggaatctttc
(ga)20 16 3 13 76.5 0.483 314-665
NKS25 f- tccatgcatgcgtgtagttt r- agtgcacaacgttcttgctg
(ag)27 18 1 17 89.5 0.452 184-712
NKS26 f- gttctcgacatgggcctact r- ctgcactttcggtccttttt
(tg)18 9 1 8 88.8 0.557 118-979
NKS28 f- gtgctgggattctgagcttc r- gcaagttcttggcctttgtt
(ag)27 16 4 12 75.0 0.477 218-679
NKS31 f- aaccaccactcatcgtcctc r- caccgagttcccattgttct
(cgg)8 16 5 11 68.6 0.393 77-831
NKS32 f- ccaactcactcaccccagtt r- atgagagtgcagatgcatgg
(tc)36 26 5 21 80.8 0.499 89-858
NKS33 f- acaggagcgcttggagatta r- gagcagaagggctagaagca
(tgt)6 19 2 17 89.5 0.652 84-912
NKS40 f- gatggaggctttgcaatgat r- gcatgtcccactgaactgaa
(tg)36 13 0 13 100 0.663 118-689
NKS43 f- gtgctgggattctgagcttc r- gcaagttcttggcctttgtt
(tg)20 13 0 13 100 0.642 83-855
NKS46 f- acaataaccccgcagacatc r- taatgcgtcatttggagcag
(tg)24 8 1 7 87.5 0.559 184-574
NKS50 f- cgaaggaccagttgaaagga r- atggaacaggacacaccaca
(tg)41 8 4 4 50.0 0.195 128-584
NKS59 f- gttagcattgctgggaggag r- tctagctgggcaattccaaa
(tg)23 9 2 7 77.8 0.494 117-623
NKS61 f- ttggacatggcaagtctttg r- aggaacctcccaagaacaca
(gt)16 17 4 13 76.5 0.483 214-605
NKS76 f- ccaacaacgaattgtgcatgt r- cctggttggctacctgtcttca
(ca)31 16 1 15 93.8 0.657 118-979
214 36 178 83.2 0.526
TB, Total no. of bands amplified; MB, Monomorphic bands; PB, Polymorphic bands; PP, Per cent polymorphism; PIC, Polymorphism information content
analysis using an unweighted pair-group method with arithmetic averages (UPGMA) and results were plotted as a dendrogram.
Results and Discussion
Polymorphism Revealed by RAPD and STMS Markers
Molecular markers are abundantly available, simple and quick to use, and more importantly are reproducible.
Thus offer many advantages over morphological and biochemical markers. Among different types of DNA markers used, AFLP, RAPD and STMS markers are used for diversity analysis, mapping, MAS and identification of hybrids in sugarcane5,6,8-10.
In the present investigation, a total of 221 and 214 amplicons were detected among 23 high biomass producing sugarcane hybrids with respect to RAPD and STMS primers. In RAPD, the number of DNA fragments generated by each primer ranged from 8 (OPV13 & OPV14) to 27 (OPG15) averaging 14.8, with amplicon size ranging from 106-1383 bp (Table 2).
The number of bands amplified in high biomass producing sugarcane hybrids was higher than reported earlier for commercial sugarcane hybrids6,8. This could be because the study material consisted of diverse clones from near commercial sugarcane hybrids to interspecific and intergeneric hybrids. Of 224 bands amplified, 73.3% were polymorphic across the hybrids (Table 2). The polymorphism percent varied from 48 (OPG15) to 100% (OPG17, OPO16 &
OPV13). The level of polymorphism detected among these hybrids was higher than the polymorphism existing in commercial sugarcane hybrids in India7,10.
STMS (15) primer pairs produced a total of 145 amplicons across high biomass producing sugarcane hybrids, of which 178 were polymorphic, accounting for 83.2% of total amplicons. Number of amplicon varied from 8 (NKS46 & NKS50) to 26 (NKS32), and sizes ranged from 77 to 979 bp. The number and range of markers amplified in these sugarcane hybrids were higher than reported earlier elsewhere11 and comparable with Indian sugarcane clones6. Average number of amplicons and polymorphic fragments per primer pairs were 14.2 and 11.8, respectively. In the earlier studies, each SSR primer pair amplified 4.9 alleles on average within an F1 mapping population12, while an average of 8 alleles were amplified by each SSR within unrelated germplasm13. Two primer pairs (NKS40 & NKS43) exhibited 100%
polymorphism, while least polymorphism (50 %) was shown by NKS50. The highest number of polymorphic bands was found with the primer
NKS32, while the lowest polymorphic bands were detected with the primer NKS50. All primers used in this study produced ~69% polymorphism, except NKS50. The observed level of polymorphism was comparable to that reported in sugarcane and related members of the family Poaceae3,14.
The PIC values ranged from 0.121 (OPG2 & OPG15) to 0.631 (OPG17) with an average of 0.447 for RAPD, and 0.195 (NKS50) to 0.663 (NKS40) with an average of 0.526 for STMS markers. Three RAPD (OPJ9, OPO16 &
OPV13) and four STMS (NKS33, 40, 43 & 76) markers gave PIC values equal to or more than 0.6, indicating their potential utility to detect differences among the hybrids. OPG15 (RAPD) and NKS50 (STMS) gave very low PIC values of less than 0.20, and they might not be useful in discriminating hybrids. In general, primers which showed more number of monomorphic bands gave less PIC value and vice versa.
Hybrid Specific RAPD and STMS Markers
RAPD and STMS markers genetic fingerprints were generated for 23 high biomass producing sugarcane hybrids. Unique DNA markers were identified either as present or absent in that particular genotype/hybrid.
Based on the pattern of marker distribution among the hybrids seven unique hybrids could be identified (Table 3). Three out of ten RAPD makers identified two hybrids with absence of unique band, while STMS markers identified six genotypes with either presence or absence of unique DNA fragments. The RAPD markers OPG151527 identified the hybrids SSCD 1875, and OPJ92167 and OPJ161176 identified the genotype NCo 310 with the absence of markers.
Table 3—Unique or rare DNA fragments produced by RAPD and STMS markers
No. Primer Unique/rare band size
Variety identified
Status of marker
I RAPD (bp)
OPG15 1527 SSCD 1875 Absent
OPJ9 2167 NCO 310 Absent
OPJ16 1176 NCO 310 Absent
II STMS
NKS31 190 012909 Present
NKS31 831 IA 3135 Present
NKS33 84 IA 1167 Absent
NKS33 97 IA 1167 Absent
NKS33 808 IA 1167 Present
NKS43 725 NCO 310 Absent
NKS76 680 SSCD 1006 Present
NKS76 1074 IGHENI 3 Present
NKS59 125 SSCD 1006 Absent
NKS59 143 SSCD 1006 Present
NKS59 175 IGHENI 3 Present
NKS59 583 SSCD 1006 Present
In case of STMS, NKS31 identified ISH 01-2909 and IA 3135 with the presence of 190 bp and 831 bp markers, respectively. IA 1167 had the presence (NKS33808) and absence (NKS3384,97) of specific markers. NKS43 produced 725 bp fragment specific to NCo 310. Presence of 143 bp and 583 bp, and 175 bp marker generated by NKS59 identified SSCD 1006 and IGHENI 3, respectively; while absence of NKS59125 identified SSCD 1006. Presence of NKS76680 and NKS761074 identified SSCD 1006 and IGEENI 3, respectively. NCo 310 was the only variety identified with the absence of both RAPD and STMS markers. Many reports have suggested occurrence of unique/rare markers in sugarcane5,6,8,15,16
but occurrence of rare markers depends on genotype and kind of markers used. Thus STMS markers may be deployed for efficient identification of specific sugarcane hybrids.
Genetic Similarity Using RAPD and STMS Analysis
The genetic diversity among the 23 high biomass producing hybrids estimated as Jaccard’s similarity coefficient ranged from 0.542 to 0.844 with an average of 0.720 for RAPD, and 0.452 to 0.854 with an average of 0.740 for STMS (data not shown).
Existence of high genetic similarity among the sugarcane hybrids grown in India5,6,8,10 and among the foreign hybrids17 were reported earlier. The highest genetic similarity detected by RAPD between IA 1167 and IA 3135 could be due to the fact that both the high biomass canes were developed from ‘Co’
cane crossed with S. spontaneum. The latter was one of the parents for development of ‘Co’ canes by crossing with S. officinarum. The lowest similarity was estimated between hybrid pairs IGHENI 3 and NCo 310 (0.542), followed by between IGH 07-1828 and SSCD 1006 (0.544). The former pair of hybrids had diverse pedigree as IGHENI 3 had Erianthus arundinaceus genome, while NCo 310 had only S. officinarum and S. spontaneum genome in their respective pedigree. These two species, E. arundinaceus and S. spontaneum, are highly divergent in the evolutionary pathways. In latter pair of hybrids IGH 07-1828 and SSCD 1006, IGH 07-1828 has S. robustum and E. arundinaceous in its pedigree, while SSCD 1006 was derived from commercial cane and S. spontaneum. Genetic similarity co-efficient of less than 0.60 was recorded between hybrid pairs SSCD 849 and IGHENI 3 (0.591), GUK 00-1226 and SSCD 1006 (0.589), and IGH 07-1974 and SSCD 1006 (0.598).
The highest genetic similarity was detected between the hybrids 97 R 383 and CoPant 92226 (0.874) based on STMS generated markers, while the lowest genetic similarity was observed between hybrids IGHENI 3 and SSEA × Co 62118 (0.478), and SSCD 1006 and SSEA × Co 62118 (0.478). The hybrids that showed high genetic similarity were advanced generation commercial hybrids enriched with agronomically important genes, whereas the hybrids that exhibited lowest genetic similarity were derived from parental stocks of diverse origin (Table 1). The genealogy of hybrids SSCD 1006 and IGH 07-4249 indicates that S. spontaneum contributed in the genome of former, while S. robustum and E. arundinaceous in the latter. Strong molecular differentiation between Erianthus spp. and Saccharum spp. had already been demonstrated with rDNA spacers18, RFLP19, AFLP20 and TRAP markers21.
Clustering of Genotype Based on Similarity Coefficient
The clustering pattern of the high biomass producing sugarcane hybrids as revealed by RAPD and STMS markers is shown in the dendrograms (Figs 1 & 2). Overall, grouping of hybrids could be due to parentage and parental-offspring relationships between the hybrids. Based on RAPD marker analysis, three clusters were formed. Cluster Ia consisted of high sucrose commercial genotypes (NCo 310, CoPant 92226 & Co 86032), while cluster Ib contained eight hybrids, viz., 97 R 383, NG 77-18, IGH 07-1974, ISH 01-2909, IGH 07-4249, IGH 07-4263, 94 GUK 2454 and 94 GUK 2437. The hybrids under cluster Ib include S. officinarum or the derivatives of “Co cane”. The cluster IIa comprised of eight hybrids (GUK 00-1226, SSCD 849, 985401, SSCD 1006, SSCD 944, SSCD 1875, IGH 07-1828 and SSEA × Co 62198; while hybrids IA 3135 and IA 1167 were present in cluster IIb. Interestingly, the hybrids of cluster II had commercial cane (‘Co’ cane) and S. spontaneum in their immediate pedigree.
Hybrid derivatives between Erianthus and N1
nobilised cane formed the out group cluster III.
Erianthus spp. have generated a lot of interest due to presence of largely desirable phenotypic characters like high fibre and biomass, drought tolerance, water logging tolerance and disease resistance. To date, only few number of intergeneric hybrids involving Erianthus spp. and S. officinarum has been reported22. Although RAPD is a dominant marker, they could able to group the clones into unique clusters based on
their genome complement due to the diversity existing among the clones under study.
Six clusters were formed based on STMS marker analysis. Six hybrids each grouped together in clusters Ia and Ib. These clusters had all the near commercial sugarcane hybrids with S. officinarum and S. spontaneum in the pedigree. Again the hybrids with common parents formed unique group. For example, two hybrids (IGH 07-4249 & IGH 07-4263) had a common female parent [04 (24) RE-150] and different male parents of commercial status. The cluster II had
two hybrids (94 GUK 2437 & 94 GUK 2454) with same immediate parents. The high efficiency of the STMS markers is evident from grouping of 94 GUK 2437 and 94 GUK 2454 selected from the same cross combination involving E. arundinaceous as one of the parent.
S. spontaneum is the common genome present in the four hybrids (SSEA × Co 62198, SSCD 1006, SSCD 1875 and SSCD 944) in the cluster III. S. spontaneum is found in immediate pedigree of six clones, viz., SSCD 944, SSCD 1875, SSCD 1006, SSCD 849, IA 1167 and IA 3135, but first three clones were grouped in cluster
Fig. 1—UPGMA dendrogram showing genetic relationships among the 23 high biomass producing sugarcane hybrids based on RAPD marker analysis.
Fig. 2—UPGMA dendrogram showing genetic relationships among the 23 high biomass producing sugarcane hybrids based on STMS marker analysis.
III and last three were grouped in cluster I. Segregation of different S. spontaneum derived clones may be due to the higher polymorphism exhibited by different clones.
It has been widely accepted that the majority of genetic variability among modern sugarcane cultivars is largely due to the introgression of the highly polymorphic S. spontaneum genome23. The inability of the separation of hybrid ISH 01-2909 of S. robustum and S. spontaneum from NG 77-18, a S. officinarum clone, in the cluster IV might be due to the less number of markers used in the study. However, the clone ISH 07-1974 is derivative of different S. officinarum clones formed independent cluster V. Hybrid derivatives between Erianthus and N1 nobilised cane formed the cluster VI. As like the previous report5,6,8, both RAPD and STMS were efficient markers for characterization of sugarcane hybrids, even in case of those with common parentage. STMS was found to be more efficient for cultivar identification and assessing diversity.
Acknowledgement
Authors would like to acknowledge the Indian Council of Agricultural Research (ICAR), Government of India, New Delhi for financially supporting the present work. They also wish to thank Dr Vijayan Nair, Director and Dr M N Premachandran, the Head, Division of Crop Improvement, Sugarcane Breeding Institute, Coimbatore for kindly providing genetically pure clones of the sugarcane hybrids.
References
1 Sugar Statistics, in Sugarcane, sugar and molasses production at a glance, Cooperative Sugar, 45 (2014) 44.
2 D'Hont A, Souza G M, Menossi M, Vincentz M, Van-Sluys M-A et al,Sugarcane: A major source of sweetness, alcohol, and bio-energy, in Genomics of tropical crop plants, edited by P H Moore and R Ming (Springer, New York) 2008, 483-513.
3 Chandra-Shekara A C, Prasanna B M, Bhat S R & Singh B B, Genetic diversity analysis of elite pearl millet inbred lines using RAPD and SSR markers, J Plant Biochem Biotechnol, 16 (2007) 23-28.
4 Doyle J J & Doyle J L, A rapid DNA isolation procedure for small quantities of fresh leaf tissue, Phytochem Bull, 19 (1987) 11-15.
5 Govindaraj P, Sindhu R, Balamurugan A & Appunu C, Molecular diversity in sugarcane hybrids (Saccharum spp.
complex) grown in peninsular and east coast zones of tropical India, Sugar Tech, 13 (2011) 206-213.
6 Sindhu R, Govindaraj P, Balamurugan A & Appunu C, Genetic diversity in sugarcane hybrids (Saccharum spp.
complex) grown in tropical India based on STMS markers, J Plant Biochem Biotechnol, 20 (2011) 118-124.
7 Rohlf F J, NTSYS-pc: Numerical taxonomy and multivariate analysis system, version 2.10 (Exeter Software, Setauket, New York) 2002.
8 Govindaraj P, Ramesh R, Appunu C, Swapna S & Priji P J, DNA fingerprinting of subtropical sugarcane (Saccharum spp.) genotypes using sequences tagged microsatellites sites (STMS) markers,Plant Archives, 12 (2012) 347-352.
9 Hemaprabha G, Govindaraj P, Balasundaram N & Singh N K, Genetic diversity analysis of Indian sugarcane breeding pool based on sugarcane specific STMS markers, Sugar Tech, 7 (2005) 9-14.
10 Selvi A, Nair N V, Noyer J L, Singh N K, Balasundaram N et al, Genomic constitution and genetic relationship among the tropical and subtropical Indian sugarcane cultivars revealed by AFLP, Crop Sci, 45 (2005) 1750-1757.
11 Piperidis G, Progress towards evaluation of SSR as a tool for sugarcane variety identification, paper presented to 4th Int Soc Sugar Cane Technol (ISSCT) Mol Biol Workshop, Montpellier, France, 7-11 April, 2003.
12 Aitken K S, Jackson P A & McIntyre C L, A combination of AFLP and SSR markers provides extensive map coverage and identification of homo(eo)logous linkage groups in a sugarcane cultivar, Theor Appl Genet, 110 (2005) 789-801.
13 Cordeiro G M, Taylor G O & Henry R J, Characterization of microsatellite markers from sugarcane (Saccharum sp.), a highly polyploid species, Plant Sci, 155 (2000) 161-168.
14 Wong S C, Yiu P H, Bong S T W, Lee H H, Neoh P N P et al, Analysis of Sarawak Bario rice diversity using microsatellite markers, Am J Agric Biol Sci, 4 (2009) 298-304.
15 Tabasum S, Khan F A, Nawaz S, Iqbal M Z & Saeed A, DNA profiling of sugarcane genotypes using randomly amplified polymorphic DNA, Genet Mol Res, 9 (2010) 417-483.
16 Zhang H Y, Li F S, He I L, Zhong H Q, Yang Q H et al, Identification of sugarcane interspecies hybrids with RAPDs, Afr J Biotechnol, 7 (2008) 1072-1074.
17 Alvi A K, Iqbal J, Shah A H & Pan Y-B, DNA based genetic variation for red rot resistance in sugarcane, Pak J Bot, 40 (2008) 1419-1425.
18 Al-Janabi S M, McClelland M, Petersen C & Sobral B W S, Phylogenetic analysis of organellar DNA sequences in the Andropogoneae: Saccharinae, Theor Appl Genet, 88 (1994) 933-944.
19 Burnquist W, Sorrells M & Tanksley S, Characterization of genetic variability in Saccharum germplasm by means of restriction fragment length polymorphism (RFLP) analysis, Proc Int Soc Sugar Cane Technol, 21 (1992) 255-365.
20 Besse P, Taylor G, Carroll B, Berding N, Burner D et al, Assessing genetic diversity in a sugarcane germplasm collection using an automated AFLP analysis, Genetica, 104 (1998) 143-153.
21 Alwala S, Kimbeng C A, Gravois K A & Bischoff K P, TRAP, a new tool for sugarcane breeding: Comparison with AFLP and coefficient of parentage, J Am Soc Sugar Cane Technol, 26 (2006) 62-87.
22 Piperidis G, Christopher M J, Carroll B J, Berding N &
D’Hont A, Molecular contribution to selection of inter- generic hybrids between sugarcane and the wild species Erianthus arundinaceus, Genome, 43 (2000) 1033-1037.
23 D’Hont A, Grivet L, Feldmann P, Rao S, Berding N et al, Characterisation of the double genome structure of modern sugarcane cultivars (Saccharum spp.) by molecular cytogenetics, Mol Gen Genet, 250 (1996) 405-413.
